Full data view for gene RMRP

Information The variants shown are described using the NR_003051.3 transcript reference sequence.

102 entries on 2 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2     Next › Last »



AscendingDNA change (cDNA)     


RNA change     



DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


dbSNP ID     

Germline/Somatic/De novo     






















Panel size     

+?/+? - n.-25_-4dupTACTACTCTGTGAAGCTGAGGA - r.? - Unknown g.35658019_35658040dup - -5_-26dupTACTACTCTGTGAAGCTGAGAA - RMRP_000022 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-24_-18dupACTACTC - r.? - Unknown g.35658033_35658039dup - g.-19_-25 dupACTACTC - RMRP_000002 1 Thai CHH patient (hom) PubMed: Vatanavicharn et al. 2010 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-24_-12dup - r.? - Unknown g.35658027_35658039dup - -25_-13dup - RMRP_000012 1 CHH family (com-het) with undetermined ethnicity PubMed: Kavadas et al. 2008 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-24_-10dupACTACTCTGTGAAGC - r.? - Unknown g.35658025_35658039dup - g.-25_-11 dupACTACTCTGTGAAGC; -25_-11dup; -11_-25dupACTACTCTGTGAAGC - RMRP_000014 1 German and 1 Spanish CHH patient and 1 CHH family with undetermined ethnicity (all com-het) PubMed: Hermanns el al. 2006, PubMed: Munoz-Robles et al. 2006, PubMed: Kavadas et al. 2008 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-24_-4dupACTACTCTGTGAAGCTGAGGA - r.? - Unknown g.35658019_35658039dup - g.-25_-5dupACTACTCTGTGAAGCTGAGGA; -25_-5dup; 6_-25dupACTACTCTGTGAAGCTGAGA - RMRP_000023 1 German CHH family and 2 Belgian siblings, 1 CHH family with undetermined ethnicity (all com-het) PubMed: Bonafe et al. 2005, PubMed: Hermanns el al. 2006, PubMed: Kavadas et al. 2008 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-23_-14dupCTACTCTGTG - r.? - Unknown g.35658029_35658038dup - -15_-24dupCTACTCTGTG - RMRP_000009 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-22-6dupTACTCTGTGAAGCTGAG - r.? - Unknown g.35658021_35658037dup - -23-8dupTACTCTGTGAAGCTGAG - RMRP_000016 1 CHH patient (com-het) with undetermined ethnicity PubMed: Fuente et al. 2011 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-22_-14dupTACTCTGTG - r.? - Unknown g.35658029_35658037dup - g.-23_-15dupTACTCTGTG - RMRP_000010 1 French CHH family (com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-22_-13dupTACTCTGTGA - r.? - Unknown g.35658028_35658037dup - dupTACTCTGTGA at -13; g.-23_-14dupTACTCTGTGA - RMRP_000004 2 Finnish CHH families (com-het) and 1 French CHH family (com-het) PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-22_-3dupTACTCTGTGAAGCTGAGGAC - r.? - Maternal (confirmed) g.35658018_35658037dup - 20 bp duplication (TACTCTGTGAAGCTGAGGAC) at nt -3; n.-4_-23dupTACTCTGTGAAGCTGAGGAC - RMRP_000025 1 Japanese CHH family and 1 German CHH patient (all com-het) PubMed: Harada et al. 2005, PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-21_-9dupACTCTGTGAAGCT - r.? - Unknown g.35658024_35658036dup - g.-22_-10dupACTCTGTGAAGCT - RMRP_000015 1 French CHH family (com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+/+ - n.-20_-19insTCTGTGAAGCTGGGGAC - r.0 - Unknown g.35658034_35658035insGTCCCCAGCTTCACAGA - n.-21_-20insTCTGTGAAGCTGGGGAC - RMRP_000001 2 Japanese CHH families (com-het) PubMed: Nakashima et al. 2003, PubMed: Hirose et al. 2006 - SUMMARY record yes 0/65 JAP CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-20_1dupCTCTGTGAAGCTGAGGACGTG - r.? - Unknown g.35658015_35658035dup - -1_-21dupCTCTGTGAAGCTGAGGACGTG - RMRP_000034 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-19_-13dupTCTGTGA - r.? - Unknown g.35658028_35658034dup - dup TCTGTGA at -13; g.-20_-14dupTCTGTGA; -14_-20dupTCTGTGA; -20-14dup - RMRP_000011 2 American CHH families, 1 American CHH patient and 1 CHH family with undetermined ethnicity (all com-het) PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005, PubMed: Hermanns el al. 2006, PubMed: Kavadas et al. 2008 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-19_-3dupTCTGTGAAGCTGAGGAC - r.? - Paternal (confirmed) g.35658018_35658034dup - dupTCTGTGAAGCTGAGGAC at g.-3; -20_-4dupTCTGTGAAGCTGAGGAC - RMRP_000026 1 English and 1 Swiss CHH family (both com-het) PubMed: Ridanpää et al. 2001, PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-18_-17insCTCACTACTC - r.? - Maternal (confirmed) g.35658032_35658033insGAGTAGTGAG - M29916.1: g.726_727insCTCACTACTC - RMRP_000103 1 patient with CHH (com-het); 10-nucleotide insertion at position -18 in the promoter region of the RMRP gene PubMed: Crahes et al. 2013 - SUMMARY record yes - - 0 - - - - - - - - - - - - - - - - - - -
+?/+? - n.-15_-6dupTGAAGCTGAG - r.? - Unknown g.35658021_35658030dup - dup TGAAGCTGAG at -6 - RMRP_000032 1 French CHH family (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-15_1dupTGAAGCTGAGGACGTG - r.? - Paternal (confirmed) g.35658015_35658030dup - 16-bp dup at +1 - RMRP_000035 1 Japanese CHH family (com-het) PubMed: Hirose et al. 2006 - SUMMARY record yes 0/65 JAP CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-14_3dupGAAGCTGAGGACGTGGT - r.? - Maternal (confirmed) g.35658013_35658029dup - 17-bp duplication (GAAGCTGAGGACGTGGT) at +3; 17-bp dup at +3 - RMRP_000039 6 Japanese CHH families (com-het) PubMed: Nakashima et al. 2003, PubMed: Hirose et al. 2006 - SUMMARY record yes 0/65 JAP CON - - - - - - - - - - - - - - - - - - - - -
+/+ - n.-13_-12insATCTGTG - r.0 - Maternal (confirmed) g.35658027_35658028insCACAGAT - insertion ATCTGTG at -13 - RMRP_000013 1 CHH patient with undetermined ethnicity (com-het) PubMed: Roifman et al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-13_-6dupAAGCTGAG - r.? - Unknown g.35658021_35658028dup - dup AAGCTGAG at -6 - RMRP_000020 1 Mexican CHH family (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-13_-2dupAAGCTGAGGACG - r.? - Paternal (confirmed) g.35658017_35658028dup - dup(aagctgaggacg) at -2; g.-14_-3dupAAGCTGAGGACG - RMRP_000028 1 Swiss and 1 Swiss-Danish CHH family (both com-het) PubMed: Bonafe et al. 2002, PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/60 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-13_1dupAAGCTGAGGACGTG - r.? - Unknown g.35658015_35658028dup - dup AAGCTGAGGACGTG at 1 - RMRP_000036 1 American CHH family (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+/+ - n.-10_-9insTACTCTGTGAAGTACTCTGTGAAGCTGA - r.0 - Unknown g.35658024_35658025insTCAGCTTCACAGAGTACTTCACAGAGTA - insertion TACTCTGTGAAGTACTCTGTGAAGCTGA at -10 (including 2 times duplication) - RMRP_000003 1 CHH patient PubMed: Roifman et al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-10_-4delCTGAGGAins28 - r.? - Unknown g.35658019_35658025delins28 - -11_-5delCTGAGGAins28bp - RMRP_000024 1 CHH family (com-het) with undetermined ethnicity PubMed: Kavadas et al. 2008 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-8_-1dupGAGGACGT - r.? - Unknown g.35658016_35658023dup - -9_-2dup - RMRP_000029 1 CHH family (com-het) with undetermined ethnicity PubMed: Kavadas et al. 2008 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-7_1dupAGGACGTG - r.? - Unknown g.35658015_35658022dup - g.-8_-1dupAGGACGTG - RMRP_000037 1 Canadian CHH family (com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+/+ - n.-6_-5insCCTGAG - r.0 - Maternal (confirmed) g.35658020_35658021insCTCAGG - insCCTGAG at -6 - RMRP_000033 1 German CHH family (com-het) PubMed: Ridanpää et al. 2001, PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-6_4dupGGACGTGGTT - r.? - Unknown g.35658012_35658021dup - dup GGACGTGGTT at 4 - RMRP_000040 1 Brazilian CHH family (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-4_-3insGGACGTGGTT - r.? - Unknown g.35658018_35658019insAACCACGTCC - ins GGACGTGGTT at -4 - RMRP_000027 1 French CHH family (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-3_1dupCGTG - r.? - Unknown g.35658015_35658018dup - -4_-1dup - RMRP_000038 1 CHH family (com-het) with undetermined ethnicity PubMed: Kavadas et al. 2008 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-20_-13CTCTGTGA[3] - r.? - Unknown g.35658028_35658035[3] - -21_-14trip - RMRP_000021 1 CHH family (com-het) with undetermined ethnicity PubMed: Kavadas et al. 2008 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+/+ - n.-24_-10ACTACTCTGTGAAGC[3] - r.0 - Paternal (confirmed) g.35658025_35658039[3] - Two times dupACTACTCTGTGAAGC at -10 - RMRP_000030 1 Swiss CHH family (com-het) PubMed: Ridanpää et al. 2001, PubMed: Ridanpää et al. 2002 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.-24_-9ACTACTCTGTGAAGCT[3] - r.? - Unknown g.35658024_35658039[3] - g.-25_-10tripACTACTCTGTGAAGCT - RMRP_000031 1 Italian CHH family (com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.5C>T - r.5c>u - Unknown g.35658011G>A - 4T; g.4C>T; 4C>T - RMRP_000018 1 Australian, 1 Dutch, 1 English, 1 German, 1 Spanish, 1 Swiss and 1 Italian CHH family, 1 German CHH patient and 2 CHH patients and 1 CHH family with undetermined ethnicity (all com-het) PubMed: Ridanpää et al. 2002, PubMed: Bonafe 2005, PubMed: Roifman 2006, PubMed: Hermanns 2006, PubMed: Munoz-Robles 2006 and PubMed: Kavadas 2008, PubMed: Bacchetta 2009 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.10T>C - r.10u>c - Unknown g.35658006A>G - 9T>C - RMRP_000019 1 German CHH patient (com-het) PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
?/? - n.12A>G - r.12a>g - Parent #1 g.35658004T>C - g.11A>G reported previously as polymorphisms - RMRP_000041 - PubMed: Kwan et al. 2012 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.15G>T - r.15g>u - Parent #1 g.35658001C>A - 14G>T - RMRP_000042 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.19G>C - r.19g>c - Parent #1 g.35657997C>G - g.G18>C - RMRP_000043 1 CHH patient (com-het) with undetermined ethnicity PubMed: Fuente et al. 2011 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.28G>A - r.28g>a - Parent #1 g.35657988C>T - g.G27>A - RMRP_000044 1 CHH patient (hom) with undetermined ethnicity PubMed: Fuente et al. 2011 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.36C>T - r.36c>u - Parent #1 g.35657980G>A - g.35C>T - RMRP_000045 1 French CHH family (com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.41G>A - r.41g>a - Parent #1 g.35657975C>T - g.40G>A - RMRP_000046 1 Dutch CHH family (com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.46_54dupTGTTCCTCC - r.46_54dupuguuccucc - Parent #1 g.35657962_35657970dup - g.45_53dupTGTTCCTCC - RMRP_000047 1 Dutch CHH family (com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.57_58insTTCCGCCT - r.57_58insuuccgccu - Parent #1 g.35657958_35657959insAGGCGGAA - ins TTCCGCCT at 57 - RMRP_000048 1 French CHH family (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.62G>A - r.62g>a - Parent #1 g.35657954C>T - g.G61>A - RMRP_000049 1 CHH patient (com-het) with undetermined ethnicity PubMed: Fuente et al. 2011 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.64C>T - r.64c>u - Parent #1 g.35657952G>A - 63T; g.63C>T - RMRP_000050 4 Dutch and 2 Australian CHH families, 1 French and 1 Caucasian-Afrikan-American CHH family (all com-het) PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005, PubMed: Kuijpers et al. 2003 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.65T>C - r.65u>c - Parent #1 g.35657951A>G - g.64T>C - RMRP_000051 1 Italian CHH family (com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.69_70delinsTT - r.69_70delinsuu - Parent #1 g.35657946_35657947delinsAA - g.68_69delinsTT - RMRP_000052 1 CHH patient (com-het) with undetermined ethnicity PubMed: Horn et al. 2010 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+/+ - n.71A>G - r.71a>g - Unknown g.35657945T>C - 70A>G - RMRP_000005 Finnish Major CHH mutation, (90> Finnish CHH families; most homozygous), and also the most common mutation (~48%) in other countries: Observed in American (also Amish), Australian, Austrian, Belgian, Brazilian, Canadian, Dutch, English, French, German, Turkish, Irish and Mexican CHH patients PubMed: Ridanpää et al. 2001&PubMed: 2002, PubMed: Bonafe et al. 2002&PubMed: 2005 and others PubMed: 2006, PubMed: 2008, PubMed: 2011, PubMed: 2012, PubMed: 2013 - SUMMARY record yes 10/845 FIN CON - 0 - - - - - - - - - - - - - - - - - - -
+?/+? - n.77C>T - r.77c>u - Parent #1 g.35657939G>A - g.76C>T - RMRP_000053 1 CHH patient (com-het) with undetermined ethnicity PubMed: Horn et al. 2010 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.78C>T - r.78c>u - Parent #1 g.35657938G>A - g.77C>T - RMRP_000054 1 CHH patient (com-het) with undetermined ethnicity PubMed: Bacchetta et al. 2009 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.80G>A - r.80g>a - Parent #1 g.35657936C>T - 79A - RMRP_000055 1 American CHH family (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.81G>A - r.81g>a - Parent #1 g.35657935C>T - 80G>A - RMRP_000056 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.90C>G - r.90c>g - Parent #1 g.35657926G>C - 89C>G - RMRP_000057 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.92G>A - r.92g>a - Parent #1 g.35657924C>T - 91G>A - RMRP_000058 1 Belgian CHH patient (com-het); Variants n.91G>A and n.101C>T are in same haplotype and it is unclear which of them is (or both are) causative PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.93dupA - r.93dupa - Parent #1 g.35657923dup - g.92_93insA - RMRP_000059 1 Turkish CHH family (com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.94G>C - r.94g>c - Parent #1 g.35657922C>G - g.93G>C - RMRP_000060 1 Dutch CHH family (com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.95_96delAG - r.95_96delag - Parent #1 g.35657920_35657921delCT - del AG at 94 - RMRP_000061 1 English CHH family (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.97_98dupTG - r.97_98dupug - Parent #1 g.35657918_35657919dup - 98dupTG; dup TG at 98; g.96_97dupTG - RMRP_000063 2 Canadian and 2 Swiss CHH families (all com-het), 1 Turkish CHH family (hom) PubMed: Ridanpää et al. 2002, PubMed: Ridanpää et al. 2001, PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.98G>A - r.98g>a - Parent #1 g.35657918C>T - g.97G>A - RMRP_000062 1 German CHH family and 1 American CHH patient (all com-het) PubMed: Bonafe et al. 2005, PubMed: Hermanns el al. 2006 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.102C>T - r.102c>u - Unknown g.35657914G>A - 101C>T - RMRP_000102 1 Belgian CHH patient (com-het); Variants n.91G>A and n.101C>T are in same haplotype and it is unclear which of them is (or both are) causative PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.117A>G - r.117a>g - Parent #1 g.35657899T>C - 116A>G - RMRP_000064 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.119A>G - r.119a>g - Parent #1 g.35657897T>C - 118G - RMRP_000065 1 German CHH patient (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.125C>T - r.125c>u - Parent #1 g.35657891G>A - 124C>T - RMRP_000066 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.127C>T - r.127c>u - Parent #1 g.35657889G>A - 126T; g126C>T - RMRP_000067 1 Arabian CHH family (hom), 1 Italian and 1 Turkish CHH family (both com-het) PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.128G>A - r.128g>a - Parent #1 g.35657888C>T - g.127G>A - RMRP_000068 1 Italian and 1 Canadian CHH family (both com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
?/? - n.128G>C - r.128g>c - Parent #1 g.35657888C>G - 127G>C - RMRP_000069 1 American CHH patient (het) PubMed: Hermanns el al. 2006 - SUMMARY record yes 0/200 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.147G>A - r.147g>a - Parent #1 g.35657869C>T - 146A; g.146G>A - RMRP_000070 1 Chinese CHH family (hom), 1 French CHH family (com-het) and 2 CHH families (com-het) with undetermined ethnicity PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005, PubMed: Kavadas et al. 2008 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.147G>C - r.147g>c - Parent #1 g.35657869C>G - g.146G>C - RMRP_000071 1 Italian CHH family (com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.153A>G - r.153a>g - Parent #1 g.35657863T>C - 152G - RMRP_000072 1 Canadian CHH family (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.155G>C - r.155g>c - Parent #1 g.35657861C>G - 154G>C - RMRP_000073 1 CHH family (com-het) with undetermined ethnicity PubMed: Kavadas et al. 2008 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.155G>T - r.155g>u - Unknown g.35657861C>A - 154T - RMRP_000006 1 Finnish CHH family (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.169G>A - r.169g>a - Maternal (confirmed) g.35657847C>T - 168G>A - RMRP_000075 1 Japanese CHH family (com-het) PubMed: Hirose et al. 2006 - SUMMARY record yes 0/65 JAP CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.180_181insC - r.180_181insc - Parent #1 g.35657835_35657836insG - 179_180insC - RMRP_000077 1 American CHH patient (com-het) PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.181G>A - r.181g>a - Parent #1 g.35657835C>T - 180A - RMRP_000076 2 Mexican CHH family, 2 German and 2 American CHH patients (all com-het) PubMed: Ridanpää et al. 2002, PubMed: Hermanns el al. 2006 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.183G>A - r.183g>a - Unknown g.35657833C>T - 182G>A - RMRP_000078 1 Japanese CHH family (com-het) PubMed: Nakashima et al. 2003, PubMed: Hirose et al. 2006 - SUMMARY record yes 0/65 JAP CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.183G>C - r.183g>c - Parent #1 g.35657833C>G - 182C - RMRP_000079 1 Dutch, 1 English and 1 Japanese CHH family (all com-het) PubMed: Ridanpää et al. 2002, PubMed: Hirose et al. 2006 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.183G>T - r.183g>u - Parent #1 g.35657833C>A - g.182G>T - RMRP_000080 1 German CHH family and 1 German CHH patient (all com-het) PubMed: Bonafe et al. 2005, PubMed: Hermanns el al. 2006 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.194G>A - r.194g>a - Parent #1 g.35657822C>T - 193G>A; 193A; g.193G>A - RMRP_000081 2 Canadian CHH families, 1 German CHH family, 1 English CHH patient and 1 CHH family with undetermined ethnicity (all com-het) PubMed: Ridanpää et al. 2001, PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005, PubMed: Kavadas et al. 2008 - SUMMARY record yes 0/205 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.195dupT - r.195dupu - Paternal (confirmed) g.35657821dup - InsT195; 194-195insT - RMRP_000082 1 CHH family and 1 American CHH patient (all com-het) PubMed: Kuijpers et al. 2003, PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.196C>T - r.196c>u - Parent #1 g.35657820G>A - 195T; 195C>T; g.195C>T - RMRP_000083 2 American and 2 Italian CHH families, 1 Israeli, 1 Brazilian, 1 Swiss and 1 Swiss-Danish CHH family, 1 American and 1 Spanish-Mexican CHH patient (all com-het) PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2002, PubMed: Bonafe et al. 2005, PubMed: Hermanns el al. 2006, PubMed: Thiel et al. 2007 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.212C>G - r.212c>g - Unknown g.35657804G>C - C211G - RMRP_000007 1 Finnish, 1 American and 1 Polish CHH family and 1 German CHH patient (all com-het) PubMed: Ridanpää et al. 2002, PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.214C>G - r.214c>g - Parent #1 g.35657802G>C - g.213C>G - RMRP_000084 1 German CHH family and 1 German CHH patient (all com-het) PubMed: Bonafe et al. 2005, PubMed: Hermanns el al. 2006 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.215A>T - r.215a>u - Parent #1 g.35657801T>A - 214T - RMRP_000085 1 German CHH patient (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.218C>T - r.218c>u - Paternal (confirmed) g.35657798G>A - 217C>T - RMRP_000086 1 Japanese CHH family (com-het) PubMed: Hirose et al. 2006 - SUMMARY record yes 0/65 JAP CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.219A>G - r.219a>g - Parent #1 g.35657797T>C - 218A>G - RMRP_000087 6 Japanese CHH families (all com-het) PubMed: Nakashima et al. 2003, PubMed: Harada et al. 2005, PubMed: Hirose et al. 2006 - SUMMARY record yes 0/65 JAP CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.221T>C - r.221u>c - Parent #1 g.35657795A>G - g.220T>C - RMRP_000088 1 Italian and 1 German CHH family (both com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.231C>T - r.231c>u - Parent #1 g.35657785G>A - 230T - RMRP_000089 1 Polish CHH family (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.237A>G - r.237a>g - Parent #1 g.35657779T>C - 236G - RMRP_000090 1 American CHH family (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.239C>T - r.239c>u - Parent #1 g.35657777G>A - 238T; 238C>T; g.238C>T - RMRP_000091 2 Austrian CHH families, 1 American, 1 Australian and 1 Israeli CHH family (all com-het) PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2002, PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.241A>C - r.241a>c - Paternal (confirmed) g.35657775T>G - A240C; 240A>C - RMRP_000092 1 CHH family and 1 CHH patient with undetermined ethnicity (all com-het) PubMed: Roifman et al. 2006, PubMed: Kavadas et al. 2008 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.243A>G - r.243a>g - Parent #1 g.35657773T>C - 242G; g.242A>G; 242A>G - RMRP_000093 1 Brazilian and 2 Canadian CHH families (all com-het) and 2 CHH families (com-het) with undetermined ethnicity PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005, PubMed: Kavadas et al. 2008 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.244C>T - r.244c>u - Parent #1 g.35657772G>A - 243T - RMRP_000094 1 Canadian CHH family (com-het) PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.245G>A - r.245g>a - Parent #1 g.35657771C>T - g.244G>A - RMRP_000095 1 German CHH family (com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.249C>T - r.249c>u - Parent #1 g.35657767G>A - g.248C>T - RMRP_000096 1 Canadian CHH family (com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.257_266delCAGCGCGGCT - r.257_266delcagcgcggcu - Parent #1 g.35657750_35657759delAGCCGCGCTG - 256_265delCAGCGCGGCT; g.254_263delCTCAGGCGCGG - RMRP_000101 1 Spanish-Mexican CHH family and 2 American CHH patients (all com-het) PubMed: Hermanns el al. 2006, PubMed: Thiel et al. 2007 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.261C>G - r.261c>g - Parent #1 g.35657755G>C - g.260C>G - RMRP_000097 1 Italian CHH family (com-het) PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/100 CAU CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.262C>T - r.262c>u - Parent #1 g.35657754G>A - 261T; g.261C>T - RMRP_000098 1 Israeli and 1 Trinidadian CHH family (both homo) PubMed: Ridanpää et al. 2002, PubMed: Bonafe et al. 2005 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.263G>C - r.263g>c - Parent #1 g.35657753C>G - 262G>C - RMRP_000099 2 German CHH patients (com-het) PubMed: Hermanns el al. 2006 - SUMMARY record yes - - - - - - - - - - - - - - - - - - - - - -
+?/+? - n.263G>T - r.263g>u - Unknown g.35657753C>A - 262G>T - RMRP_000008 13 Finnish CHH families (com-het) PubMed: Ridanpää et al. 2001, PubMed: Ridanpää et al. 2002 - SUMMARY record yes 0/280 CON - - - - - - - - - - - - - - - - - - - - -
Legend   « First ‹ Prev     1 2     Next › Last »

Gene encodes RNA component of mitochondrial RNA processing endoribonuclease, no protein of this gene is produced