All transcript variants in gene SURF1

Information The variants shown are described using the NM_003172.3 transcript reference sequence.

69 entries on 1 page. Showing entries 1 - 69.
Legend  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. - c.-212G>A r.(?) p.(=) - likely benign g.136223541C>T g.133356665C>T SURF2(NM_001278928.1):c.73C>T (p.(Arg25Cys)) - SURF1_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. 1 c.19_35del r.(?) p.(Leu7Glyfs*47) - - g.136223302_136223318del g.133356426_133356442del - - SURF1_000018 - Trujillano et al., submitted - - Germline - - - 0 - Daniel Trujillano
-?/. - c.54+10G>A r.(=) p.(=) - likely benign g.136223266C>T g.133356390C>T SURF1(NM_003172.3):c.54+10G>A - RPL7A_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.54+34_55-47del r.? p.? - benign g.136223246_136223266del g.133356370_133356390del SURF1(NM_003172.3):c.54+34_55-47delTGCGGGGTGCGGGGTGCGGGG - SURF1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
+/? 1i c.55-1G>A r.spl p.? - - g.136223176C>T g.133356321C>T - - SURF1_000010 - - - - Unknown - - - 0 - Inn-Chi Lee
+/? 1i c.55-1G>A r.spl p.? - - g.136223176C>T g.133356321C>T - - SURF1_000010 - - - - Unknown - - - 0 - Inn-Chi Lee
+/? 2i c.106+1G>C r.spl p.? - - g.136223123C>G g.133356268C>G - - SURF1_000012 - - - - Unknown - - - 0 - Inn-Chi Lee
+/? 2i c.106+1G>C r.spl p.? - - g.136223123C>G g.133356268C>G - - SURF1_000012 - - - - Unknown - - - 0 - Inn-Chi Lee
+/? 2i c.107-2A>G r.spl p.? - - g.136221814T>C g.133354959T>C - - SURF1_000013 - - - - Unknown - - - 0 - Inn-Chi Lee
?/. - c.140C>G r.(?) p.(Ser47Cys) - VUS g.136221779G>C g.133354924G>C SURF1(NM_003172.3):c.140C>G (p.S47C) - RPL7A_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.167C>G r.(?) p.(Ala56Gly) - likely benign g.136221752G>C g.133354897G>C SURF1(NM_003172.3):c.167C>G (p.A56G) - SURF1_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
+/? 3 c.169del r.(?) p.(Glu57Lysfs*15) - - g.136221751del g.133354896del - - SURF1_000002 - - - - Unknown - - - 0 - Inn-Chi Lee
+/. 3 c.180del r.(?) p.(Leu62Phefs*10) - pathogenic g.136221740del g.133354885del - - SURF1_000019 - - - - Germline - - - 0 - Andreas Laner
+/? 3 c.183_186del r.(?) p.(Leu62Serfs*9) - - g.136221736_136221739del g.133354881_133354884del 183_186delTCTT - SURF1_000006 - - - - Unknown - - - 0 - Inn-Chi Lee
+/. - c.209_210del r.(?) p.(Pro70ArgfsTer31) - pathogenic g.136221709_136221710del g.133354854_133354855del SURF1(NM_003172.3):c.209_210delCT (p.P70Rfs*31) - SURF1_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
+/. - c.240+1G>T r.spl? p.? - pathogenic g.136221678C>A g.133354823C>A SURF1(NM_003172.3):c.240+1G>T - RPL7A_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.240+21T>C r.(=) p.(=) - likely benign g.136221658A>G g.133354803A>G SURF1(NM_003172.3):c.240+21T>C - SURF1_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
+/. - c.241-1G>C r.spl p.? - pathogenic g.136221597C>G g.133354742C>G - - SURF1_000036 - - - - Uniparental disomy, paternal allele - - - 0 - Wenjuan Qiu
+?/. - c.269T>C r.(?) p.(Leu90Pro) - likely pathogenic g.136221568A>G g.133354713A>G SURF1(NM_003172.3):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. - c.269T>C r.(?) p.(Leu90Pro) - likely pathogenic g.136221568A>G g.133354713A>G SURF1(NM_003172.3):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. - c.280T>C r.(?) p.(Leu94=) - benign g.136221557A>G g.133354702A>G SURF1(NM_003172.3):c.280T>C (p.L94=) - SURF1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.280T>C r.(?) p.(Leu94=) - benign g.136221557A>G g.133354702A>G SURF1(NM_003172.3):c.280T>C (p.L94=) - SURF1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. - c.311_312insA r.(?) p.(Leu105SerfsTer14) - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. - c.311_312insA r.(?) p.(Leu105SerfsTer14) - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.311_312insA r.(?) p.(Leu105SerfsTer14) - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. - c.312_321delinsAT r.(?) p.(Leu105*) - pathogenic g.136221516_136221525delinsAT g.133354661_133354670delinsAT 312_321delGGCTGGCAGAinsAT - SURF1_000026 - - - - Unknown - - - 0 - IMGAG
+/? 4 c.312_321delinsAT r.312_321delinsau p.Leu105* - - g.136221516_136221525delinsAT g.133354661_133354670delinsAT - - SURF1_000014 Protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - 0 - Carl Fratter
+/? 4 c.312_321delinsAT r.312_321delinsau p.Leu105* - - g.136221516_136221525delinsAT g.133354661_133354670delinsAT - - SURF1_000014 Protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - 0 - Carl Fratter
+/? 4 c.312_321delinsAT r.312_321delinsau p.Leu105* - - g.136221516_136221525delinsAT g.133354661_133354670delinsAT - - SURF1_000014 protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - 0 - Carl Fratter
+/? 4 c.312_321delinsAT r.312_321delinsau p.Leu105* - - g.136221516_136221525delinsAT g.133354661_133354670delinsAT - - SURF1_000014 protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - 0 - Carl Fratter
+/. - c.313_321del r.(?) p.(Leu105_Ala107del) - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del) - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.313_321del r.(?) p.(Leu105_Ala107del) - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del) - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. - c.313_321del r.(?) p.(Leu105_Ala107del) - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del) - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. - c.324-11T>C r.(=) p.(=) - - g.136220806A>G g.133353951A>G - - SURF1_000040 1 heterozygous, no homozygous; Clinindb (India) Faruq 2020, submtted - rs375398247 Germline - 1/2795 individuals - 0 - Mohammed Faruq
+/? 4i c.324-11T>G r.spl? p.(=) - - g.136220806A>C g.133353951A>C - - SURF1_000009 - - - - Unknown - - - 0 - Inn-Chi Lee
+/? 4i c.324-11T>G r.spl p.(=) - - g.136220806A>C g.133353951A>C - - SURF1_000009 - - - - Unknown - - - 0 - Inn-Chi Lee
+/? 4i c.324-11T>G r.324_515del p.Asp108_Gly172delinsGlu - - g.136220806A>C g.133353951A>C - - SURF1_000009 protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - 0 - Carl Fratter
?/. - c.350A>C r.(?) p.(Tyr117Ser) - VUS g.136220769T>G g.133353914T>G SURF1(NM_003172.2):c.350A>C (p.(Tyr117Ser)) - RPL7A_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.371G>A r.(?) p.(Gly124Glu) - VUS g.136220748C>T g.133353893C>T - - RPL7A_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/? 5 c.472_473del r.(?) p.(Ser158Trpfs*21) - - g.136220648_136220649del g.133353793_133353794del 472_473delAG - SURF1_000007 - - - - Unknown - - - 0 - Inn-Chi Lee
?/. - c.498C>G r.(?) p.(Phe166Leu) - VUS g.136220621G>C g.133353766G>C SURF1(NM_003172.2):c.498C>G (p.(Phe166Leu)) - RPL7A_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
+/? 5i c.516-2A>G r.spl p.? - - g.136219623T>C g.133352768T>C - - SURF1_000008 - - - - Unknown - - - 0 - Inn-Chi Lee
+/? 5i c.516-2A>G r.spl p.? - - g.136219623T>C g.133352768T>C - - SURF1_000008 - - - - Unknown - - - 0 - Inn-Chi Lee
+?/. - c.516-2A>G r.spl? p.? - likely pathogenic g.136219623T>C g.133352768T>C - - SURF1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - c.543C>T r.(?) p.(Phe181=) - benign g.136219594G>A g.133352739G>A SURF1(NM_003172.3):c.543C>T (p.F181=) - RPL7A_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/? 6 c.555_556del r.(?) p.(Lys186Serfs*4) - - g.136219582_136219583del g.133352727_133352728del 555_556delGA - SURF1_000003 - - - - Unknown - - - 0 - Inn-Chi Lee
-/. - c.573C>G r.(?) p.(Thr191=) - benign g.136219564G>C g.133352709G>C SURF1(NM_003172.3):c.573C>G (p.T191=) - SURF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.573C>G r.(?) p.(Thr191=) - benign g.136219564G>C g.133352709G>C SURF1(NM_003172.3):c.573C>G (p.T191=) - SURF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/? 7 c.614G>A r.(?) p.(Gly205Glu) - - g.136219438C>T g.133352583C>T - - SURF1_000005 - - - - Unknown - - - 0 - Inn-Chi Lee
-?/. - c.694C>T r.(?) p.(Leu232=) - likely benign g.136219358G>A g.133352503G>A SURF1(NM_003172.3):c.694C>T (p.L232=) - RPL7A_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.745A>G r.(?) p.(Asn249Asp) - VUS g.136219307T>C g.133352452T>C SURF1(NM_003172.3):c.745A>G (p.N249D) - RPL7A_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.745A>G r.(?) p.(Asn249Asp) - VUS g.136219307T>C g.133352452T>C SURF1(NM_003172.3):c.745A>G (p.N249D) - RPL7A_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.751+6T>C r.(=) p.(=) - likely benign g.136219295A>G g.133352440A>G SURF1(NM_003172.3):c.751+6T>C - SURF1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
?/. 7i c.752-65A>T r.(=) p.(=) - VUS g.136219062T>A g.133352207T>A - - SURF1_000034 - - - - Germline - - - 0 - Andreas Laner
+/? 8 c.769G>A r.(?) p.(Gly257Arg) - - g.136218980C>T g.133352125C>T - - SURF1_000004 - - - - Unknown - - - 0 - Inn-Chi Lee
+/? 8 c.792_793del r.792_793del p.Arg264Serfs*27 - - g.136218958_136218959del g.133352103_133352104del 792_793delAG - SURF1_000017 protein change predicted from RNA Nesbitt et al., submitted - - Germline - - - 0 - Carl Fratter
+/? 8 c.799_800del r.799_800del p.Leu267Glufs*24 - - g.136218951_136218952del g.133352096_133352097del 799_800delCT - SURF1_000016 protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - 0 - Carl Fratter
+/? 8 c.807_810delins9 r.(?) p.? - - g.? - c.807_810del4ins9 - SURF1_000001 description variant incomplete (ins9) - - - Unknown - - - 0 - Inn-Chi Lee
?/. - c.823A>T r.(?) p.(Ile275Phe) - VUS g.136218926T>A g.133352071T>A SURF1(NM_003172.3):c.823A>T (p.I275F) - SURF1_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+?/. - c.827_828del r.(?) p.Val276Aspfs*15 ACMG likely pathogenic g.136218922_136218923del g.133352067_133352068del - - SURF1_000035 Clinical Leigh-Syndrome, parents consanguineous (from Syria) - - - Germline - - - 0 - Andreas Laner
./. 8i c.833+1G>A r.spl? p.? - - g.136218915C>T g.133352060C>T g.4716G>A - SURF1_000011 - - - - Germline - - - 0 - Sudha Kohli
+/? 8i c.833+1G>A r.spl p.? - - g.136218915C>T g.133352060C>T - - SURF1_000011 - - - - Unknown - - - 0 - Inn-Chi Lee
+/? 8i c.833+1G>A r.spl p.? - - g.136218915C>T g.133352060C>T - - SURF1_000011 - - - - Unknown - - - 0 - Inn-Chi Lee
-/. - c.833+13C>T r.(=) p.(=) - benign g.136218903G>A g.133352048G>A SURF1(NM_003172.3):c.833+13C>T - SURF1_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
+/. - c.845_846del r.(?) p.(Ser282Cysfs*9) - pathogenic g.136218829_136218830del g.133351974_133351975del 845_846delCT - SURF1_000025 - - - - Unknown - - - 0 - IMGAG
+?/. - c.846_849dup r.(?) p.(Ala284Cysfs*9) - - g.136218822_136218825dup g.133351967_133351970dup - - SURF1_000022 - - - - Germline - - - 0 - Sudha Kohli
-/. - c.883C>T r.(?) p.(Arg295Cys) - benign g.136218788G>A g.133351933G>A SURF1(NM_003172.3):c.883C>T (p.R295C) - RPL7A_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 9_ c.*177T>C r.(=) p.(=) - VUS g.136218591A>G g.133351736A>G - - SURF1_000020 - - - - Germline - - - 0 - Andreas Laner
?/. 9_ c.*178G>C r.(=) p.(=) - VUS g.136218590C>G g.133351735C>G - - SURF1_000021 - - - - Germline - - - 0 - Andreas Laner
Legend