Full data view for gene SURF1

Information The variants shown are described using the NM_003172.3 transcript reference sequence.

65 entries on 1 page. Showing entries 1 - 65.
Legend  

Effect     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     

Allele     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age/Death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
-?/. - c.-212G>A likely benign r.(?) p.(=) Unknown g.136223541C>T - SURF2(NM_001278928.1):c.73C>T (p.(Arg25Cys)) - SURF1_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. 1 c.19_35del - r.(?) p.(Leu7Glyfs*47) Both (homozygous) g.136223295_136223311del g.133356419_133356435del - - SURF1_000018 - Trujillano et al., submitted - - Germline - - - 0 - DNA SEQ, SEQ-NG - - LS - Trujillano et al., submitted unaffected parents - - - - - 0 - - 1 Daniel Trujillano
-?/. - c.54+10G>A likely benign r.(=) p.(=) Unknown g.136223266C>T - SURF1(NM_003172.3):c.54+10G>A - RPL7A_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.54+34_55-47del benign r.(?) p.(=) Unknown g.136223246_136223266del - SURF1(NM_003172.3):c.54+34_55-47delTGCGGGGTGCGGGGTGCGGGG - SURF1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/? 1i c.55-1G>A - r.spl p.? Parent #2 g.136223176C>T - - - SURF1_000010 - - - - Unknown - - - 0 - DNA, RNA RT-PCR, SEQ - - LS - - - F - United States Caucasian - 0 - - 1 Inn-Chi Lee
+/? 1i c.55-1G>A - r.spl p.? Parent #1 g.136223176C>T - - - SURF1_000010 - - - - Unknown - - - 0 - DNA, RNA RT-PCR, SEQ - - LS - - - F - United States Caucasian - 0 - - 1 Inn-Chi Lee
+/? 2i c.106+1G>C - r.spl p.? Both (homozygous) g.136223123C>G - - - SURF1_000012 - - - - Unknown - - - 0 - RNA RT-PCR - - LS - - - - - - - - 0 - - 1 Inn-Chi Lee
+/? 2i c.106+1G>C - r.spl p.? Both (homozygous) g.136223123C>G - - - SURF1_000012 - - - - Unknown - - - 0 - DNA SEQ - - LS - - - F - United States Pakistani 3y6m 0 - - 1 Inn-Chi Lee
+/? 2i c.107-2A>G - r.spl p.? Both (homozygous) g.136221814T>C - - - SURF1_000013 - - - - Unknown - - - 0 - DNA, RNA RT-PCR, SEQ - - LS - - - M - United States Caucasian - 0 - - 1 Inn-Chi Lee
?/. - c.140C>G VUS r.(?) p.(Ser47Cys) Unknown g.136221779G>C - SURF1(NM_003172.3):c.140C>G (p.S47C) - RPL7A_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.167C>G likely benign r.(?) p.(Ala56Gly) Unknown g.136221752G>C - SURF1(NM_003172.3):c.167C>G (p.A56G) - SURF1_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/? 3 c.169delG - r.(?) p.(Glu57Lysfs*15) Unknown g.136221750delC - - - SURF1_000002 - - - - Unknown - - - 0 - DNA SEQ - - LS - - - - - - - - 0 - - 1 Inn-Chi Lee
+/. 3 c.180del - r.(?) p.(Leu62Phefs*10) Parent #1 g.136221739del g.133354884del - - SURF1_000019 - - - - Germline - - - 0 - DNA SEQ - - - - - - - - Germany - - 0 - - 1 Andreas Laner
+/? 3 c.183_186del - r.(?) p.(Leu62Serfs*9) Unknown g.136221733_136221736del - 183_186delTCTT - SURF1_000006 - - - - Unknown - - - 0 - DNA SEQ - - LS - - - - - (Taiwan) - - 0 - - 1 Inn-Chi Lee
+/. - c.209_210del pathogenic r.(?) p.(Pro70Argfs*31) Unknown g.136221709_136221710del - SURF1(NM_003172.3):c.209_210delCT (p.P70Rfs*31) - SURF1_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.240+21T>C likely benign r.(=) p.(=) Unknown g.136221658A>G - SURF1(NM_003172.3):c.240+21T>C - SURF1_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.241-1G>C pathogenic r.spl p.? Paternal (confirmed) g.136221597C>G - - - SURF1_000036 - - - - Uniparental disomy, paternal allele - - - 0 - DNA SEQ-NG - - LS - - - F - China - - 0 - - 1 Wenjuan Qiu
+?/. - c.269T>C likely pathogenic r.(?) p.(Leu90Pro) Unknown g.136221568A>G - SURF1(NM_003172.3):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.269T>C likely pathogenic r.(?) p.(Leu90Pro) Unknown g.136221568A>G - SURF1(NM_003172.3):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.280T>C benign r.(?) p.(=) Unknown g.136221557A>G - SURF1(NM_003172.3):c.280T>C (p.L94=) - SURF1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.280T>C benign r.(?) p.(=) Unknown g.136221557A>G - SURF1(NM_003172.3):c.280T>C (p.L94=) - SURF1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.311_312insA pathogenic r.(?) p.(Leu105Serfs*14) Unknown g.136221525_136221526insT - SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.311_312insA pathogenic r.(?) p.(Leu105Serfs*14) Unknown g.136221525_136221526insT - SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.311_312insA pathogenic r.(?) p.(Leu105Serfs*14) Unknown g.136221525_136221526insT - SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.312_321delinsAT - r.(?) p.(Leu105*) Unknown g.136221516_136221525delinsAT - 312_321delGGCTGGCAGAinsAT - SURF1_000026 - - - - Unknown - - - 0 - DNA SEQ - - - - - - F - (Germany) - - 0 - - 1 IMGAG
+/? 4 c.312_321delinsAT - r.312_321delinsau p.Leu105* Both (homozygous) g.136221516_136221525delinsAT - - - SURF1_000014 Protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - 0 - DNA, RNA RT-PCR, SEQ - - LS - - - - ? ? (unknown) - - 0 - - 1 Carl Fratter
+/? 4 c.312_321delinsAT - r.312_321delinsau p.Leu105* Both (homozygous) g.136221516_136221525delinsAT - - - SURF1_000014 Protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - 0 - DNA, RNA RT-PCR, SEQ - - LS - - - - ? ? (unknown) - - 0 - - 1 Carl Fratter
+/? 4 c.312_321delinsAT - r.312_321delinsau p.Leu105* Both (homozygous) g.136221516_136221525delinsAT - - - SURF1_000014 protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - 0 - DNA, RNA RT-PCR, SEQ - - LS - - - - ? ? (unknown) - - 0 - - 1 Carl Fratter
+/? 4 c.312_321delinsAT - r.312_321delinsau p.Leu105* Both (homozygous) g.136221516_136221525delinsAT - - - SURF1_000014 protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - 0 - DNA, RNA RT-PCR, SEQ - - LS - - - - ? ? (unknown) - - 0 - - 1 Carl Fratter
+/. - c.313_321del pathogenic r.(?) p.(Leu105_Ala107del) Unknown g.136221516_136221524del - SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del) - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/? 4i c.324-11T>G - r.spl? p.? Both (homozygous) g.136220806A>C - - - SURF1_000009 - - - - Unknown - - - 0 - RNA RT-PCR, SEQ - - LS - - - - - - - - 0 - - 1 Inn-Chi Lee
+/? 4i c.324-11T>G - r.spl p.? Both (homozygous) g.136220806A>C - - - SURF1_000009 - - - - Unknown - - - 0 - DNA SEQ - - LS - - - F - (United States) Asian - 0 - - 1 Inn-Chi Lee
+/? 4i c.324-11T>G - r.324_515del p.Asp108_Gly172delinsGlu Both (homozygous) g.136220806A>C - - - SURF1_000009 protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - 0 - DNA, RNA RT-PCR, SEQ - - LS - - - - ? ? (unknown) - - 0 - - 1 Carl Fratter
?/. - c.350A>C VUS r.(?) p.(Tyr117Ser) Unknown g.136220769T>G - SURF1(NM_003172.2):c.350A>C (p.(Tyr117Ser)) - RPL7A_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.371G>A VUS r.(?) p.(Gly124Glu) Unknown g.136220748C>T - - - RPL7A_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/? 5 c.472_473del - r.(?) p.(Ser158Trpfs*21) Parent #1 g.136220646_136220647del - 472_473delAG - SURF1_000007 - - - - Unknown - - - 0 - DNA SEQ - - LS - - - - - - - - 0 - - 1 Inn-Chi Lee
?/. - c.498C>G VUS r.(?) p.(Phe166Leu) Unknown g.136220621G>C - SURF1(NM_003172.2):c.498C>G (p.(Phe166Leu)) - RPL7A_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/? 5i c.516-2A>G - r.spl p.? Parent #2 g.136219623T>C - - - SURF1_000008 - - - - Unknown - - - 0 - DNA, RNA RT-PCR, SEQ - - LS - - Lactic acidosis, increased pyruate, seiuzre M - United States Caucasian/Asian - 0 - - 1 Inn-Chi Lee
+/? 5i c.516-2A>G - r.spl p.? Parent #1 g.136219623T>C - - - SURF1_000008 - - - - Unknown - - - 0 - DNA, RNA RT-PCR, SEQ - - LS - - Lactic acidosis, increased pyruate, seiuzre M - United States Caucasian/Asian - 0 - - 1 Inn-Chi Lee
+?/. - c.516-2A>G likely pathogenic r.spl? p.? Unknown g.136219623T>C - - - SURF1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.543C>T benign r.(?) p.(=) Unknown g.136219594G>A - SURF1(NM_003172.3):c.543C>T (p.F181=) - RPL7A_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/? 6 c.555_556del - r.(?) p.(Lys186Serfs*4) Parent #1 g.136219581_136219582del - 555_556delGA - SURF1_000003 - - - - Unknown - - - 0 - DNA SEQ - - LS - - - - - - - - 0 - - 1 Inn-Chi Lee
-/. - c.573C>G benign r.(?) p.(=) Unknown g.136219564G>C - SURF1(NM_003172.3):c.573C>G (p.T191=) - SURF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.573C>G benign r.(?) p.(=) Unknown g.136219564G>C - SURF1(NM_003172.3):c.573C>G (p.T191=) - SURF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/? 7 c.614G>A - r.(?) p.(Gly205Glu) Parent #1 g.136219438C>T - - - SURF1_000005 - - - - Unknown - - - 0 - DNA SEQ - - LS - - - - - - - - 0 - - 1 Inn-Chi Lee
-?/. - c.694C>T likely benign r.(?) p.(=) Unknown g.136219358G>A - SURF1(NM_003172.3):c.694C>T (p.L232=) - RPL7A_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.745A>G VUS r.(?) p.(Asn249Asp) Unknown g.136219307T>C - SURF1(NM_003172.3):c.745A>G (p.N249D) - RPL7A_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.745A>G VUS r.(?) p.(Asn249Asp) Unknown g.136219307T>C - SURF1(NM_003172.3):c.745A>G (p.N249D) - RPL7A_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.751+6T>C likely benign r.(=) p.(=) Unknown g.136219295A>G - SURF1(NM_003172.3):c.751+6T>C - SURF1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. 7i c.752-65A>T - r.(=) p.(=) Parent #1 g.136219062T>A g.133352207T>A - - SURF1_000034 - - - - Germline - - - 0 - DNA SEQ - - - - - - - - Germany - - 0 - - 1 Andreas Laner
+/? 8 c.769G>A - r.(?) p.(Gly257Arg) Parent #2 g.136218980C>T - - - SURF1_000004 - - - - Unknown - - - 0 - DNA SEQ - - LS - - - - - - - - 0 - - 1 Inn-Chi Lee
+/? 8 c.792_793del - r.792_793del p.Arg264Serfs*27 Both (homozygous) g.136218956_136218957del - 792_793delAG - SURF1_000017 protein change predicted from RNA Nesbitt et al., submitted - - Germline - - - 0 - DNA, RNA RT-PCR, SEQ - - LS - - - - ? ? (unknown) - - 0 - - 1 Carl Fratter
+/? 8 c.799_800del - r.799_800del p.Leu267Glufs*24 Both (homozygous) g.136218949_136218950del - 799_800delCT - SURF1_000016 protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - 0 - DNA, RNA RT-PCR, SEQ - - LS - - 1 Family, 2 patients - yes ? (unknown) - - 0 - - 2 Carl Fratter
+/? 8 c.807_810delins9 - r.(?) p.? Unknown g.? - c.807_810del4ins9 - SURF1_000001 description variant incomplete (ins9) - - - Unknown - - - 0 - DNA SEQ - - LS - - - - - - - - 0 - - 1 Inn-Chi Lee
?/. - c.823A>T VUS r.(?) p.(Ile275Phe) Unknown g.136218926T>A - SURF1(NM_003172.3):c.823A>T (p.I275F) - SURF1_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+?/. - c.827_828del ACMG: 4 r.(?) p.Val276Aspfs*15 Both (homozygous) g.136218921_136218922del - - - SURF1_000035 Clinical Leigh-Syndrome, parents consanguineous (from Syria) - - - Germline - - - 0 - DNA SEQ-NG - - - - - - M - Germany - - 0 - - 1 Andreas Laner
./. 8i c.833+1G>A - r.spl? p.? Both (homozygous) g.136218915C>T g.133352060C>T g.4716G>A - SURF1_000011 - - - - Germline - - - 0 - DNA SEQ - - LS - - leighs (SURF1) - - - - - 0 - - 1 Sudha Kohli
+/? 8i c.833+1G>A - r.spl p.? Both (homozygous) g.136218915C>T - - - SURF1_000011 - - - - Unknown - - - 0 - RNA RT-PCR - - LS - - - - - - - - 0 - - 1 Inn-Chi Lee
+/? 8i c.833+1G>A - r.spl p.? Both (homozygous) g.136218915C>T - - - SURF1_000011 - - - - Unknown - - - 0 - DNA SEQ - - LS - - - F - United States - - 0 - - 1 Inn-Chi Lee
-/. - c.833+13C>T benign r.(=) p.(=) Unknown g.136218903G>A - SURF1(NM_003172.3):c.833+13C>T - SURF1_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.845_846del - r.(?) p.(Ser282Cysfs*9) Unknown g.136218825_136218826del - 845_846delCT - SURF1_000025 - - - - Unknown - - - 0 - DNA SEQ - - - - - - F - (Germany) - - 0 - - 1 IMGAG
+?/. - c.845_846insTGCA - r.(?) p.(Ala284Cysfs*9) Both (homozygous) g.136218825_136218826insTGCA g.133351970_133351971insTGCA - - SURF1_000022 - - - - Germline - - - 0 - DNA SEQ - - - - - - M yes India - - 0 - - 1 Sudha Kohli
-/. - c.883C>T benign r.(?) p.(Arg295Cys) Unknown g.136218788G>A - SURF1(NM_003172.3):c.883C>T (p.R295C) - RPL7A_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 9_ c.*177T>C - r.(=) p.(=) Parent #1 g.136218591A>G g.133351736A>G - - SURF1_000020 - - - - Germline - - - 0 - DNA SEQ - - - - - - - - Germany - - 0 - - 1 Andreas Laner
?/. 9_ c.*178G>C - r.(=) p.(=) Parent #1 g.136218590C>G g.133351735C>G - - SURF1_000021 - - - - Germline - - - 0 - DNA SEQ - - - - - - - - Germany - - 0 - - 1 Andreas Laner
Legend