Full data view for gene SURF1

Information The variants shown are described using the NM_003172.3 transcript reference sequence.

113 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
?/. - c.-3974C>T r.(?) p.(=) Unknown - VUS g.136227303G>A - SURF2(NM_017503.4):c.680G>A (p.(Arg227His)) - SURF1_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-3956C>T r.(?) p.(=) Unknown - likely benign g.136227285G>A g.133360409G>A SURF2(NM_001278928.1):c.662G>A (p.(Arg221Gln)) - SURF1_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-212G>A r.(?) p.(=) Unknown - likely benign g.136223541C>T g.133356665C>T SURF2(NM_001278928.1):c.73C>T (p.(Arg25Cys)) - SURF1_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. 1 c.19_35del r.(?) p.(Leu7Glyfs*47) Both (homozygous) - likely pathogenic g.136223302_136223318del g.133356426_133356442del - - SURF1_000018 - PubMed: Trujillano 2017 - - Germline - - - - - DNA SEQ, SEQ-NG - - LS - PubMed: Trujillano 2017 unaffected parents - - - - - - - - 1 Daniel Trujillano
-?/. - c.54+9C>G r.(=) p.(=) Unknown - likely benign g.136223267G>C - SURF1(NM_003172.3):c.54+9C>G - RPL7A_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.54+10G>A r.(=) p.(=) Unknown - likely benign g.136223266C>T g.133356390C>T SURF1(NM_003172.4):c.54+10G>A - RPL7A_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.54+10G>A r.(=) p.(=) Unknown - likely benign g.136223266C>T - SURF1(NM_003172.4):c.54+10G>A - RPL7A_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.54+34_55-47del r.? p.? Unknown - benign g.136223246_136223266del g.133356370_133356390del SURF1(NM_003172.4):c.54+34_55-47delTGCGGGGTGCGGGGTGCGGGG - SURF1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.54+34_55-47del r.? p.? Unknown - benign g.136223246_136223266del - SURF1(NM_003172.4):c.54+34_55-47delTGCGGGGTGCGGGGTGCGGGG - SURF1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.54+48_55-47del r.(?) p.(=) Unknown - benign g.136223260_136223266del - SURF1(NM_003172.4):c.54+48_55-47delTGCGGGG - RPL7A_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/? 1i c.55-1G>A r.spl p.? Parent #2 - pathogenic g.136223176C>T g.133356321C>T - - SURF1_000010 - - - - Unknown - - - - - DNA, RNA RT-PCR, SEQ - - LS - - - F - United States white - - - - 1 Inn-Chi Lee
+/? 1i c.55-1G>A r.spl p.? Parent #1 - pathogenic g.136223176C>T g.133356321C>T - - SURF1_000010 - - - - Unknown - - - - - DNA, RNA RT-PCR, SEQ - - LS - - - F - United States white - - - - 1 Inn-Chi Lee
?/. - c.98C>T r.(?) p.(Pro33Leu) Unknown - VUS g.136223132G>A - SURF1(NM_003172.4):c.98C>T (p.P33L) - RPL7A_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/? 2i c.106+1G>C r.spl p.? Both (homozygous) - pathogenic g.136223123C>G g.133356268C>G - - SURF1_000012 - - - - Unknown - - - - - RNA RT-PCR - - LS - - - - - - - - - - - 1 Inn-Chi Lee
+/? 2i c.106+1G>C r.spl p.? Both (homozygous) - pathogenic g.136223123C>G g.133356268C>G - - SURF1_000012 - - - - Unknown - - - - - DNA SEQ - - LS - - - F - United States Pakistani 3y6m - - - 1 Inn-Chi Lee
-/. - c.106+81G>C r.(=) p.(=) Unknown - benign g.136223043C>G - SURF1(NM_003172.4):c.106+81G>C - RPL7A_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/? 2i c.107-2A>G r.spl p.? Both (homozygous) - pathogenic g.136221814T>C g.133354959T>C - - SURF1_000013 - - - - Unknown - - - - - DNA, RNA RT-PCR, SEQ - - LS - - - M - United States white - - - - 1 Inn-Chi Lee
+/. - c.107-2A>G r.[107_240del,107-515del,107_119del,107_189del,106_107ins[107-51_107-3;gg],106_107ins[107-18_107-3;gg]] p.? Both (homozygous) - pathogenic (recessive) g.136221814T>C g.133354959T>C - - SURF1_000013 - PubMed: Echaniz-Laguna 2013 - - Germline yes - - - - DNA, RNA, protein microscope, PAGE, RT-PCR, Western - - CMT FamPatII10 PubMed: Echaniz-Laguna 2013 2 generation family, 12 siblings, 2 affected (F, M) M yes France Algeria >42y - ? - 2 Maeve Soen
+/. 2i c.107-2A>G r.[107_240del,107-515del,107_119del,107_189del,106_107ins[107-51_107-3;gg],106_107ins[107-18_107-3;gg] p.? Both (homozygous) - pathogenic (recessive) g.136221814T>C g.133354959T>C - - SURF1_000013 - PubMed: Echaniz-Laguna 2013 - - Germline yes - - - - DNA, RNA, protein microscope, PAGE, RT-PCR, Western - - CMT FamPatII2 PubMed: Echaniz-Laguna 2013 older sister F yes France Algeria >57y - - - 1 Maeve Soen
-?/. - c.130T>A r.(?) p.(Cys44Ser) Unknown - likely benign g.136221789A>T - SURF1(NM_003172.3):c.130T>A (p.C44S) - RPL7A_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.140C>G r.(?) p.(Ser47Cys) Unknown - VUS g.136221779G>C g.133354924G>C SURF1(NM_003172.4):c.140C>G (p.S47C) - RPL7A_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.167C>G r.(?) p.(Ala56Gly) Unknown - benign g.136221752G>C g.133354897G>C SURF1(NM_003172.4):c.167C>G (p.A56G) - SURF1_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/? 3 c.169del r.(?) p.(Glu57Lysfs*15) Unknown - pathogenic g.136221751del g.133354896del - - SURF1_000002 - - - - Unknown - - - - - DNA SEQ - - LS - - - - - - - - - - - 1 Inn-Chi Lee
+/. 3 c.180del r.(?) p.(Leu62Phefs*10) Parent #1 - pathogenic g.136221740del g.133354885del - - SURF1_000019 - - - - Germline - - - - - DNA SEQ - - - - - - - - Germany - - - - - 1 Andreas Laner
+/? 3 c.183_186del r.(?) p.(Leu62Serfs*9) Unknown - pathogenic g.136221736_136221739del g.133354881_133354884del 183_186delTCTT - SURF1_000006 - - - - Unknown - - - - - DNA SEQ - - LS - - - - - (Taiwan) - - - - - 1 Inn-Chi Lee
+/. - c.209_210del r.(?) p.(Pro70ArgfsTer31) Unknown - pathogenic g.136221709_136221710del g.133354854_133354855del SURF1(NM_003172.4):c.209_210delCT (p.P70Rfs*31) - SURF1_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.240+1G>T r.spl? p.? Unknown - pathogenic g.136221678C>A g.133354823C>A SURF1(NM_003172.4):c.240+1G>T - RPL7A_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.240+1G>T r.spl? p.? Unknown - pathogenic g.136221678C>A - SURF1(NM_003172.4):c.240+1G>T - RPL7A_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.240+9C>T r.(=) p.(=) Unknown - likely benign g.136221670G>A - SURF1(NM_003172.4):c.240+9C>T - RPL7A_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.240+21T>C r.(=) p.(=) Unknown - likely benign g.136221658A>G g.133354803A>G SURF1(NM_003172.4):c.240+21T>C - SURF1_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.241-1G>C r.spl p.? Paternal (confirmed) - pathogenic g.136221597C>G g.133354742C>G - - SURF1_000036 - - - - Uniparental disomy, paternal allele - - - - - DNA SEQ-NG - - LS - - - F - China - - - - - 1 Wenjuan Qiu
+/. - c.269T>C r.(?) p.(Leu90Pro) Unknown - pathogenic g.136221568A>G g.133354713A>G SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.269T>C r.(?) p.(Leu90Pro) Unknown - likely pathogenic g.136221568A>G g.133354713A>G SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.269T>C r.(?) p.(Leu90Pro) Unknown - likely pathogenic g.136221568A>G g.133354713A>G SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.269T>C r.(?) p.(Leu90Pro) Unknown - likely pathogenic g.136221568A>G - SURF1(NM_003172.2):c.269T>C (p.(Leu90Pro)), SURF1(NM_003172.3):c.269T>C (p.L90P), SURF1(NM_003172.4):c.269T>C (p.L90P) - RPL7A_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.280T>C r.(?) p.(Leu94=) Unknown - benign g.136221557A>G g.133354702A>G SURF1(NM_003172.4):c.280T>C (p.L94=) - SURF1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.280T>C r.(?) p.(Leu94=) Unknown - benign g.136221557A>G g.133354702A>G SURF1(NM_003172.4):c.280T>C (p.L94=) - SURF1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.311_312insA r.(?) p.(Leu105SerfsTer14) Unknown - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.311_312insA r.(?) p.(Leu105SerfsTer14) Unknown - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.311_312insA r.(?) p.(Leu105SerfsTer14) Unknown - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.311_312insA r.(?) p.(Leu105SerfsTer14) Unknown - pathogenic g.136221525_136221526insT g.133354670_133354671insT SURF1(NM_003172.2):c.311_312insA (p.(Leu105SerfsTer14)), SURF1(NM_003172.3):c.311_312insA (p.L105Sfs*14), SURF1(NM_003172.4):c.311_312insA (p.L105...) - RPL7A_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.312_321delinsAT r.(?) p.(Leu105*) Unknown - pathogenic g.136221516_136221525delinsAT g.133354661_133354670delinsAT 312_321delGGCTGGCAGAinsAT - SURF1_000026 - - - - Unknown - - - - - DNA SEQ - - ? - - - F - (Germany) - - - - - 1 IMGAG
+/? 4 c.312_321delinsAT r.312_321delinsau p.Leu105* Both (homozygous) - pathogenic g.136221516_136221525delinsAT g.133354661_133354670delinsAT - - SURF1_000014 Protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - - - DNA, RNA RT-PCR, SEQ - - LS - - - - ? - - - - - - 1 Carl Fratter
+/? 4 c.312_321delinsAT r.312_321delinsau p.Leu105* Both (homozygous) - pathogenic g.136221516_136221525delinsAT g.133354661_133354670delinsAT - - SURF1_000014 Protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - - - DNA, RNA RT-PCR, SEQ - - LS - - - - ? - - - - - - 1 Carl Fratter
+/? 4 c.312_321delinsAT r.312_321delinsau p.Leu105* Both (homozygous) - pathogenic g.136221516_136221525delinsAT g.133354661_133354670delinsAT - - SURF1_000014 protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - - - DNA, RNA RT-PCR, SEQ - - LS - - - - ? - - - - - - 1 Carl Fratter
+/? 4 c.312_321delinsAT r.312_321delinsau p.Leu105* Both (homozygous) - pathogenic g.136221516_136221525delinsAT g.133354661_133354670delinsAT - - SURF1_000014 protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - - - DNA, RNA RT-PCR, SEQ - - LS - - - - ? - - - - - - 1 Carl Fratter
+/. - c.313_321del r.(?) p.(Leu105_Ala107del) Unknown - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC... - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.313_321del r.(?) p.(Leu105_Ala107del) Unknown - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC... - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.313_321del r.(?) p.(Leu105_Ala107del) Unknown - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC... - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.313_321del r.(?) p.(Leu105_Ala107del) Unknown - pathogenic g.136221516_136221524del g.133354661_133354669del SURF1(NM_003172.2):c.313_321del (p.(Leu105_Ala107del)), SURF1(NM_003172.3):c.313_321delCTGCCAGCC (p.L105_A107del), SURF1(NM_003172.4):c.313_321delC... - RPL7A_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.321C>T r.(?) p.(=) Unknown - likely benign g.136221516G>A - SURF1(NM_003172.4):c.321C>T (p.A107=) - RPL7A_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.324-11T>C r.(=) p.(=) Parent #1 - pathogenic g.136220806A>G g.133353951A>G - - SURF1_000040 1 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs375398247 Germline - 1/2795 individuals - - - DNA arraySNP - Infinium Global Screening Array v1.0 ? - PubMed: Narang 2020, Journal: Narang 2020 analysis 2794 individuals (India) - - India - - - - - 1 Mohammed Faruq
+/? 4i c.324-11T>G r.spl? p.(=) Both (homozygous) - pathogenic g.136220806A>C g.133353951A>C - - SURF1_000009 - - - - Unknown - - - - - RNA RT-PCR, SEQ - - LS - - - - - - - - - - - 1 Inn-Chi Lee
+/? 4i c.324-11T>G r.spl p.(=) Both (homozygous) - pathogenic g.136220806A>C g.133353951A>C - - SURF1_000009 - - - - Unknown - - - - - DNA SEQ - - LS - - - F - (United States) Asian - - - - 1 Inn-Chi Lee
+/? 4i c.324-11T>G r.324_515del p.Asp108_Gly172delinsGlu Both (homozygous) - pathogenic g.136220806A>C g.133353951A>C - - SURF1_000009 protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - - - DNA, RNA RT-PCR, SEQ - - LS - - - - ? - - - - - - 1 Carl Fratter
+?/. - c.324-2A>G r.spl? p.? Unknown - likely pathogenic g.136220797T>C - SURF1(NM_003172.4):c.324-2A>G - RPL7A_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.335T>C r.(?) p.(Leu112Pro) Unknown - VUS g.136220784A>G - SURF1(NM_003172.4):c.335T>C (p.(Leu112Pro)) - RPL7A_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.350A>C r.(?) p.(Tyr117Ser) Unknown - VUS g.136220769T>G g.133353914T>G SURF1(NM_003172.2):c.350A>C (p.(Tyr117Ser)), SURF1(NM_003172.4):c.350A>C (p.Y117S) - RPL7A_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.350A>C r.(?) p.(Tyr117Ser) Unknown - VUS g.136220769T>G - SURF1(NM_003172.2):c.350A>C (p.(Tyr117Ser)), SURF1(NM_003172.4):c.350A>C (p.Y117S) - RPL7A_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.371G>A r.(?) p.(Gly124Glu) Unknown - VUS g.136220748C>T g.133353893C>T - - RPL7A_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.419T>G r.(?) p.(Val140Gly) Unknown - VUS g.136220700A>C - SURF1(NM_003172.4):c.419T>G (p.V140G) - RPL7A_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.462_464del r.(?) p.(Ser155del) Unknown - VUS g.136220661_136220663del - SURF1(NM_003172.4):c.462_464delCTC (p.S155del) - RPL7A_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/? 5 c.472_473del r.(?) p.(Ser158Trpfs*21) Parent #1 - pathogenic g.136220648_136220649del g.133353793_133353794del 472_473delAG - SURF1_000007 - - - - Unknown - - - - - DNA SEQ - - LS - - - - - - - - - - - 1 Inn-Chi Lee
?/. - c.498C>G r.(?) p.(Phe166Leu) Unknown - VUS g.136220621G>C g.133353766G>C SURF1(NM_003172.2):c.498C>G (p.(Phe166Leu)) - RPL7A_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.515+20G>A r.(=) p.(=) Unknown - likely benign g.136220584C>T - SURF1(NM_003172.4):c.515+20G>A - RPL7A_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/? 5i c.516-2A>G r.spl p.? Parent #2 - pathogenic g.136219623T>C g.133352768T>C - - SURF1_000008 - - - - Unknown - - - - - DNA, RNA RT-PCR, SEQ - - LS - - Lactic acidosis, increased pyruate, seiuzre M - United States white/Asian - - - - 1 Inn-Chi Lee
+/? 5i c.516-2A>G r.spl p.? Parent #1 - pathogenic g.136219623T>C g.133352768T>C - - SURF1_000008 - - - - Unknown - - - - - DNA, RNA RT-PCR, SEQ - - LS - - Lactic acidosis, increased pyruate, seiuzre M - United States white/Asian - - - - 1 Inn-Chi Lee
+?/. - c.516-2A>G r.spl? p.? Unknown - likely pathogenic g.136219623T>C g.133352768T>C - - SURF1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.533A>G r.(?) p.(Asn178Ser) Unknown - VUS g.136219604T>C - SURF1(NM_003172.4):c.533A>G (p.N178S) - RPL7A_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 6 c.535dup r.(?) p.(Arg179LysfsTer12) Both (homozygous) - pathogenic g.136219602dup g.133352747dup - - SURF1_000042 - PubMed: Ganapathy 2019 - - Germline - - - - - DNA SEQ-NG - TruSight One panel ? S-3181 PubMed: Ganapathy 2019 - - - India - - - - - 1 Johan den Dunnen
-/. - c.543C>T r.(?) p.(Phe181=) Unknown - benign g.136219594G>A g.133352739G>A SURF1(NM_003172.4):c.543C>T (p.F181=) - RPL7A_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/? 6 c.555_556del r.(?) p.(Lys186Serfs*4) Parent #1 - pathogenic g.136219582_136219583del g.133352727_133352728del 555_556delGA - SURF1_000003 - - - - Unknown - - - - - DNA SEQ - - LS - - - - - - - - - - - 1 Inn-Chi Lee
?/. - c.563A>G r.(?) p.(Asn188Ser) Unknown - VUS g.136219574T>C - SURF1(NM_003172.4):c.563A>G (p.(Asn188Ser)) - RPL7A_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.573C>G r.(?) p.(Thr191=) Unknown - benign g.136219564G>C g.133352709G>C SURF1(NM_003172.4):c.573C>G (p.T191=) - SURF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.573C>G r.(?) p.(Thr191=) Unknown - benign g.136219564G>C g.133352709G>C SURF1(NM_003172.4):c.573C>G (p.T191=) - SURF1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.574C>T r.(?) p.(Arg192Trp) Maternal (confirmed) - pathogenic (recessive) g.136219563G>A g.133352708G>A - - SURF1_000044 - PubMed: Echaniz-Laguna 2013 - - Germline - - - - - ? ? - - CMT Fam2Pat PubMed: Echaniz-Laguna 2013 2-generation family, 1 affected, unaffected heterozygous carrier parents F no France - - - - - 1 Maeve Soen
+?/. 7 c.591T>A r.spl p.? Parent #1 ACMG likely pathogenic (recessive) g.136219461A>T g.133352606A>T - - SURF1_000045 - - 856179 - Germline yes - - - - DNA SEQ-NG oral epithelium mendelics neuromuscular disorders gene panel CPEO - - unaffected heterozygous carrier parents F no Brazil latin american - - - none 1 Beatriz Betini
-/. - c.604G>C r.(?) p.(Asp202His) Unknown - benign g.136219448C>G - SURF1(NM_003172.4):c.604G>C (p.D202H, p.(Asp202His)) - RPL7A_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.604G>C r.(?) p.(Asp202His) Unknown - likely benign g.136219448C>G - SURF1(NM_003172.4):c.604G>C (p.D202H, p.(Asp202His)) - RPL7A_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/? 7 c.614G>A r.(?) p.(Gly205Glu) Parent #1 - pathogenic g.136219438C>T g.133352583C>T - - SURF1_000005 - - - - Unknown - - - - - DNA SEQ - - LS - - - - - - - - - - - 1 Inn-Chi Lee
-?/. - c.678C>T r.(?) p.(His226=) Unknown - likely benign g.136219374G>A - SURF1(NM_003172.3):c.678C>T (p.H226=) - RPL7A_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.745A>G r.(?) p.(Asn249Asp) Unknown - VUS g.136219307T>C g.133352452T>C SURF1(NM_003172.3):c.745A>G (p.N249D), SURF1(NM_003172.4):c.745A>G (p.N249D) - RPL7A_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.745A>G r.(?) p.(Asn249Asp) Unknown - VUS g.136219307T>C g.133352452T>C SURF1(NM_003172.3):c.745A>G (p.N249D), SURF1(NM_003172.4):c.745A>G (p.N249D) - RPL7A_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.745A>G r.(?) p.(Asn249Asp) Unknown - VUS g.136219307T>C - SURF1(NM_003172.3):c.745A>G (p.N249D), SURF1(NM_003172.4):c.745A>G (p.N249D) - RPL7A_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 7 c.751C>T r.(?) p.(Gln251Ter) Both (homozygous) - pathogenic g.136219301G>A g.133352446G>A - - SURF1_000041 - PubMed: Ganapathy 2019 - - Germline - - - - - DNA SEQ-NG - TruSight One panel ? S-3233 PubMed: Ganapathy 2019 - - - India - - - - - 1 Johan den Dunnen
-/. - c.751+6T>C r.(=) p.(=) Unknown - benign g.136219295A>G g.133352440A>G SURF1(NM_003172.4):c.751+6T>C - SURF1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.751+6T>C r.(=) p.(=) Unknown - benign g.136219295A>G - SURF1(NM_003172.4):c.751+6T>C - SURF1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 7i c.752-65A>T r.(=) p.(=) Parent #1 - VUS g.136219062T>A g.133352207T>A - - SURF1_000034 - - - - Germline - - - - - DNA SEQ - - - - - - - - Germany - - - - - 1 Andreas Laner
+/. - c.752-1G>C r.spl? p.? Unknown - pathogenic g.136218998C>G - SURF1(NM_003172.4):c.752-1G>C - RPL7A_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/? 8 c.769G>A r.(?) p.(Gly257Arg) Parent #2 - pathogenic g.136218980C>T g.133352125C>T - - SURF1_000004 - - - - Unknown - - - - - DNA SEQ - - LS - - - - - - - - - - - 1 Inn-Chi Lee
+?/. - c.770G>T r.(?) p.(Gly257Val) Both (homozygous) ACMG likely pathogenic (recessive) g.136218979C>A g.133352124C>A - - SURF1_000043 - PubMed: Hu 2019 - - Germline - - - - - DNA SEQ, SEQ-NG - - ID M9000065 PubMed: Hu 2019 family, 2 affected individuals, first cousin parents - yes - Arab - - - - 2 Johan den Dunnen
+/? 8 c.792_793del r.792_793del p.Arg264Serfs*27 Both (homozygous) - pathogenic g.136218958_136218959del g.133352103_133352104del 792_793delAG - SURF1_000017 protein change predicted from RNA Nesbitt et al., submitted - - Germline - - - - - DNA, RNA RT-PCR, SEQ - - LS - - - - ? - - - - - - 1 Carl Fratter
+/? 8 c.799_800del r.799_800del p.Leu267Glufs*24 Both (homozygous) - pathogenic g.136218951_136218952del g.133352096_133352097del 799_800delCT - SURF1_000016 protein change predicted from RNA Nesbitt et al., submitted - - Germline yes - - - - DNA, RNA RT-PCR, SEQ - - LS - - 1 Family, 2 patients - yes - - - - - - 2 Carl Fratter
+/. - c.799_800del r.(?) p.(Leu267Glufs*24) Paternal (confirmed) - pathogenic (recessive) g.136218951_136218952del g.133352096_133352097del - - SURF1_000016 - PubMed: Echaniz-Laguna 2013 - - Germline - - - - - ? ? - - CMT Fam2Pat PubMed: Echaniz-Laguna 2013 2-generation family, 1 affected, unaffected heterozygous carrier parents F no France - - - - - 1 Maeve Soen
?/. - c.806A>T r.(?) p.(Asn269Ile) Unknown - VUS g.136218943T>A - SURF1(NM_003172.3):c.806A>T (p.N269I), SURF1(NM_003172.4):c.806A>T (p.(Asn269Ile)) - RPL7A_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.806A>T r.(?) p.(Asn269Ile) Unknown - VUS g.136218943T>A - SURF1(NM_003172.3):c.806A>T (p.N269I), SURF1(NM_003172.4):c.806A>T (p.(Asn269Ile)) - RPL7A_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/? 8 c.807_810delins9 r.(?) p.? Unknown - pathogenic g.? - c.807_810del4ins9 - SURF1_000001 description variant incomplete (ins9) - - - Unknown - - - - - DNA SEQ - - LS - - - - - - - - - - - 1 Inn-Chi Lee
?/. - c.823A>T r.(?) p.(Ile275Phe) Unknown - VUS g.136218926T>A g.133352071T>A SURF1(NM_003172.3):c.823A>T (p.I275F) - SURF1_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.827_828del r.(?) p.Val276Aspfs*15 Both (homozygous) ACMG likely pathogenic g.136218922_136218923del g.133352067_133352068del - - SURF1_000035 Clinical Leigh-Syndrome, parents consanguineous (from Syria) - - - Germline - - - - - DNA SEQ-NG - - - - - - M - Germany - - - - - 1 Andreas Laner
./. 8i c.833+1G>A r.spl? p.? Both (homozygous) - likely pathogenic g.136218915C>T g.133352060C>T g.4716G>A - SURF1_000011 - - - - Germline - - - - - DNA SEQ - - LS - - leighs (SURF1) - - - - - - - - 1 Sudha Kohli, Renu Saxena, Ratna Puri, I.C. Verma
Legend   How to query   « First ‹ Prev     1 2     Next › Last »


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.