All transcript variants in gene TUBGCP3

Information The variants shown are described using the NM_006322.4 transcript reference sequence.

6 entries on 1 page. Showing entries 1 - 6.
Legend  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. - c.436C>A r.(?) p.(Arg146=) - likely benign g.113212622G>T g.112558308G>T TUBGCP3(NM_001286277.1):c.406C>A (p.R136=) - TUBGCP3_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.469G>A r.(?) p.(Val157Met) - likely benign g.113212589C>T g.112558275C>T TUBGCP3(NM_001286277.1):c.439G>A (p.V147M) - TUBGCP3_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.1168+52_1168+81del r.(=) p.(=) - benign g.113201876_113201905del - TUBGCP3(NM_001286279.1):c.1220_1249delCGCGCGACTTTCCCACGCGCGACTTTCCCA (p.T407_P416del) - TUBGCP3_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.1168+67_1168+81del r.(=) p.(=) - benign g.113201891_113201905del g.112547577_112547591del TUBGCP3(NM_001286279.1):c.1235_1249delCGCGCGACTTTCCCA (p.T412_P416del) - TUBGCP3_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.1224C>G r.(?) p.(Asp408Glu) - likely benign g.113200124G>C g.112545810G>C TUBGCP3(NM_006322.4):c.1224C>G (p.(Asp408Glu)) - TUBGCP3_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.2150A>C r.(?) p.(Gln717Pro) - VUS g.113158965T>G g.112504651T>G TUBGCP3(NM_006322.6):c.2150A>C (p.Q717P) - TUBGCP3_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
Legend