Full data view for gene TUBGCP3

Information The variants shown are described using the NM_006322.4 transcript reference sequence.

6 entries on 1 page. Showing entries 1 - 6.
Legend   How to query  



AscendingDNA change (cDNA)     

RNA change     



Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     



















Age at death     




Panel size     

-?/. - c.436C>A r.(?) p.(Arg146=) Unknown - likely benign g.113212622G>T g.112558308G>T TUBGCP3(NM_001286277.1):c.406C>A (p.R136=) - TUBGCP3_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.469G>A r.(?) p.(Val157Met) Unknown - likely benign g.113212589C>T g.112558275C>T TUBGCP3(NM_001286277.1):c.439G>A (p.V147M) - TUBGCP3_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1168+52_1168+81del r.(=) p.(=) Unknown - benign g.113201876_113201905del - TUBGCP3(NM_001286279.1):c.1220_1249delCGCGCGACTTTCCCACGCGCGACTTTCCCA (p.T407_P416del) - TUBGCP3_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1168+67_1168+81del r.(=) p.(=) Unknown - benign g.113201891_113201905del g.112547577_112547591del TUBGCP3(NM_001286279.1):c.1235_1249delCGCGCGACTTTCCCA (p.T412_P416del) - TUBGCP3_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1224C>G r.(?) p.(Asp408Glu) Unknown - likely benign g.113200124G>C g.112545810G>C TUBGCP3(NM_006322.4):c.1224C>G (p.(Asp408Glu)) - TUBGCP3_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.2150A>C r.(?) p.(Gln717Pro) Unknown - VUS g.113158965T>G g.112504651T>G TUBGCP3(NM_006322.6):c.2150A>C (p.Q717P) - TUBGCP3_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query