Full data view for gene TSC1

The curator’s expert opinion on the classification of a variant, can be found in the
SUMMARY record. Regarding the classification, please note that where there are several
records of the same variant, the classification of that variant may differ depending on the
submitter’s conclusion.
Information The variants shown are described using the NM_000368.4 transcript reference sequence.

4781 entries on 48 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2 3 4 5 6 7 8 9 10 11 ...     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

P-domain     

Predict-BioInf     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
+/. _1_23_ c.-234_*4887{0} r.0? p.0? - - Unknown ACMG pathogenic (dominant) g.135663893_135948645del - - - TSC1_001479 284753bp multigene deletion; entire TSC1 deleted (ex 1-23) + 128625bp upstream of TSC1 + 102844bp downstream of TSC1; upstream deletion involves entire GFI1B, GTF3C5, LOC100996574, CEL genes; downstream deletion involves entire SPACA9 and part of AK8 PubMed: Ogorek, 2020 - - Germline ? - - - - DNA MLPA, SEQ, SEQ-NG-I Blood Targeted massive parallel sequencing, mean target coverage of 327Ă— to 1614Ă— (median 716Ă—), MLPA TSC1 P124-C1 probe mix used, Genome sequencing also done, deletion confirmed by PCR across breakpoints, gel electrophoresis and Sanger sequencing TSC 02-008 PubMed: Ogorek, 2020 infant; no history of TSC in the family; patient did not have subclinical or clinical seizures during the study M ? - - - - - - 1 Rosemary Ekong
+/+ _1_23_ c.-234_*4887{0} r.0? p.0? - - Unknown - pathogenic (dominant) g.135663893_135948645del - - - TSC1_001479 284753bp multigene deletion; entire TSC1 deleted (ex 1-23) + 128625bp upstream of TSC1 + 102844bp downstream of TSC1; upstream deletion involves entire GFI1B, GTF3C5, LOC100996574, CEL genes; downstream deletion involves entire SPACA9 and part of AK8 - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
-/- 20i c.2626-4T[17_21] r.(?) p.(=) - - Unknown - benign g.135773001A[17-21] - - - TSC1_000175 five alleles of 17-21monomer T runs (18 Ts in reference sequence) - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
-/- 9i c.914-58T[27_30] r.(?) p.(=) - - Unknown - benign g.135787013A[27_30] - - - TSC1_000330 microsatellite with base T repeated between 27 to 30 times - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
+?/+? _1_1i c.[-234-u2538_-234-u2503del(+)-234-u2506_-144+4564delins7] r.0? p.0? - - Unknown - likely pathogenic (dominant) g.? - - - TSC1_000486 36bp del upstream of ex1; another 7161bp del involves ex1 and flanking sequences, plus insertion of 7 unspecified nts. into this region (origin unknown); 45 nts. between the 2 deletions; promoter region reported as -157bp to -744bp completely deleted - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
+?/+? _1_1i c.[-234-u5895_-144+825del;chr9:g.135822115_135822270inv] r.0? p.0? - - Unknown - likely pathogenic (dominant) g.? - - - TSC1_000485 6811bp deletion; variant includes exon 1, upstream region, and a 156bp inverted sequence upstream of exon 1; promoter region reported between nts. -157bp and -744bp completely deleted - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
+?/+? _1_1i c.[-234-u9132_-144+317del(+)-234-u9141_-234-u9086inv] r.0? p.0? - - Unknown - likely pathogenic (dominant) g.? - - - TSC1_000484 9540bp deletion; variant includes exon 1, upstream region, and a 56bp inverted sequence upstream of exon 1; promoter region reported between nts. -157bp and -744bp completely deleted - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
+/. _1_23_ c.-23076_*17484del r.? p.? - - Unknown - pathogenic (dominant) g.135754139_135842863del g.132878752_132967476del c.-38403_*17484del88525 - TSC1_000491 88525bp deletion involving the entire TSC1 gene and extending into the3'UTR; no inserted or inverted nucleotides found in the TSC1 region; deletion found with TSC2 missense c.2963G>C PubMed: Sancak 2005; PubMed: van den Ouweland, 2011; PubMed: Hoogeveen-Westerveld 2011 - - De novo - 1/3 individuals tested have the variant - - - DNA MLPA, PCRq, PCRlr, SEQ Blood - TSC - PubMed: Sancak 2005; PubMed: van den Ouweland, 2011; PubMed: Hoogeveen-Westerveld 2011 sporadic case; diagnosed with definite TSC at 30yrs; patient has TSC2 missense c.2963G>C and entire deletion of TSC1; the TSC1 deletion is absent in both unaffected parents; patient has inherited TSC2 c.2963G>C from one of the parents F - - - - - - - 1 Rosemary Ekong
+/+ _1_23_ c.-23076_*17484del r.? p.? - - Unknown - pathogenic (dominant) g.135754139_135842863del g.132878752_132967476del - - TSC1_000491 88525bp deletion involving the entire TSC1 gene and extending into the3'UTR - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
-/. _1 c.-1055G>T r.(?) p.(=) - - Unknown - benign g.135820841C>A g.132945454C>A -234-u841G>T (-1055G>T) [g.2597781G>T, NT_035014.4] - TSC1_000630 reported as poly; nt. numbering for described variant in the context of TSC1 continues from TSC1 5’UTR; found with TSC2 exons 2-22 del and TSC2 missense c.5359G>A; variant upstream of TSC1 5’UTR & in upstream NTHL1 gene (as NM_002528.5:c.139+669C>A) unpublished - - Unknown - 1/3 individuals tested have the variant NdeI+ - - DNA SEQ Blood - - - - - - - - - - - - - - -
-?/-? _1 c.-1055G>T r.(?) p.(=) - - Unknown - likely benign g.135820841C>A g.132945454C>A - - TSC1_000630 nt. numbering in the context of TSC1 continues from TSC1 5’UTR (HGVS nomenclature = NG_012386.1:g.4180G>T); variant upstream of TSC1 5’UTR and is within the upstream NTHL1 gene (as NM_002528.5:c.139+669C>A) - - rs1484881165 SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
-/. _1 c.-1001_-1000delinsAA r.(?) p.(=) - - Unknown - benign g.135820786_135820787delinsTT g.132945399_132945400delinsTT -234-u787_u786 GC>AA (-1001_1000 GC>AA) - TSC1_000535 2bp deletion of GC and 2bp insertion of AA; reported as a common variant in 5' upstream region; composed of SNP rs77086994 = G>A and SNP rs11243938 = C>A unpublished - - Unknown - 26/400 individuals tested have the variant - - - DNA SEQ Blood - TSC - unpublished found in several patients; mutation-negative patients were used as controls for testing of this variant ? - - - - - - - 26 Rosemary Ekong
-/- _1 c.-1001_-1000delinsAA r.(?) p.(=) - - Unknown - benign g.135820786_135820787delinsTT g.132945399_132945400delinsTT - - TSC1_000535 2bp deletion of GC and 2bp insertion of AA; common variant in 5' upstream region; HGVS nomenclature = NG_012386.1:g.4234_4235delinsAA - - rs386739091 SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
-/. _1 c.-945T>G r.(?) p.(=) - - Unknown - benign g.135820731A>C g.132945344A>C -234-u731 T>G (-945 T>G) - TSC1_000534 common variant in 5' upstream region unpublished - rs4962225 Unknown - 12/400 individuals tested have the variant MnlI+ - - DNA SEQ Blood - TSC - unpublished found in several patients; mutation-negative patients were used as controls for testing of this variant ? - - - - - - - 12 Rosemary Ekong
-/- _1 c.-945T>G r.(?) p.(=) - - Unknown - benign g.135820731A>C g.132945344A>C - - TSC1_000534 common variant in 5' upstream region; HGVS nomenclature = NG_012386.1:g.4290T>G - - rs4962225 SUMMARY record - - MnlI+ - - - - - - - - - - - - - - - - - - - -
-/. _1 c.-822G>A r.(=) p.(=) - - Unknown - benign g.135820608C>T g.132945221C>T -234-u608 G>A (-822 G>A) - TSC1_000533 common variant in 5' upstream region unpublished - rs4962083 Unknown - 22/400 individuals tested have the variant MnlI- - - DNA SEQ Blood - TSC - unpublished found in several patients; mutation-negative patients were used as controls for testing of this variant ? - - - - - - - 22 Rosemary Ekong
-/- _1 c.-822G>A r.(?) p.(=) - - Unknown - benign g.135820608C>T g.132945221C>T - - TSC1_000533 common variant in 5' upstream region; HGVS nomenclature = NG_012386.1:g.4413G>A - - rs4962083 SUMMARY record - - MnlI- - - - - - - - - - - - - - - - - - - - -
+/. _1_1i c.-589_-144+307del r.0? p.0? - - Unknown - pathogenic (dominant) g.135819624_135820376del g.132944237_132944989del c.-16116_-15364del753 - TSC1_000487 753bp deletion involving exon 1 and flanking sequences; partial deletion of promoter region, reported between nts. -157bp and -744bp, leaving most 5' 155nts of basal transcription core still present; expression of this deletion not analysed PubMed: van den Ouweland, 2011; PubMed: Ali, 2003 - - Germline - 2/2 individuals tested have the variant DdeI-, SmaI- - - DNA MLPA, PCRq, PCRlr Blood - TSC - PubMed: van den Ouweland, 2011; PubMed: Ali, 2003 diagnosed as definite TSC at 19yrs; variant present in affected sib who has 2 major TS features F - - - - - - - 2 Rosemary Ekong
+?/+? _1_1i c.-589_-144+307del r.0? p.0? - - Unknown - likely pathogenic (dominant) g.135819624_135820376del g.132944237_132944989del - - TSC1_000487 753bp deletion involving exon 1 and flanking sequences; partial deletion of promoter region, reported between nts. -157bp and -744bp, leaving most 5' 155nts of basal transcription core still present; expression of this deletion not analysed - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
-/. _1 c.-438T>G r.(?) p.(=) - - Unknown - benign g.135820224A>C g.132944837A>C -234-u204 T>G (-438 T>G) - TSC1_000527 reported as polymorphism; variant is upstream of TSC1 and not in 5’UTR or within any known transcript; found with TSC2 exon 42 deletion and PKD1 ex 40 & 46 del; HGVS compliant description = NG_012386.1:g.4797T>G (TSC1) or NC_000009.11:g.135820224A>C unpublished - - Unknown - - HpyAV- - - DNA SEQ Blood - TSC - unpublished proband has a variant upstream of TSC1 5'UTR and a TSC2 ex42 deletion that extends into PKD1 ex46; parents not tested; mutation-negative patients used as control for testing the variant upstream of TSC1 5'UTR and variant only seen in this family ? - - - - - - - 1 Rosemary Ekong
-?/-? _1 c.-438T>G r.(?) p.(=) - - Unknown - likely benign g.135820224A>C g.132944837A>C - - TSC1_000527 variant is upstream of TSC1; HGVS compliant description = NG_012386.1:g.4797T>G (TSC1) - - rs1041499541 SUMMARY record - - HpyAV- - - - - - - - - - - - - - - - - - - - -
+/. _1_1i c.-295_-144+105del{0} r.0? p.0? - - Unknown - pathogenic (dominant) g.135819825_135820081del g.132944438_132944694del deletion exon 1, genomic deletion: 135819825 to 135820081 - TSC1_001437 exon 1 deleted; reported that NGS analysis after g.135820081 was not done; partial deletion of promoter region (reported between nts. -157bp and -744bp); deletion found with TSC2 c.4149C>T (confirmed splice variant in a different case) unpublished - - Germline - 1/2 individuals tested has the variant - - - DNA DHPLC, MLPA, SEQ, SEQ-NG Blood TSC1 deletion detected by MLPA and verified by NGS. TSC2 variant detected by DHPLC, Sanger SEQ and NGS. TSC - unpublished patient reported to have TSC1 exon 1 deletion and TSC2 silent variant c.4149C>T; the one parent tested has TSC1 c.4149C>T but not the TSC1 exon 1 deletion F - - - - - - - 1 Rosemary Ekong
?/? _1_1i c.-295_-144+105del{0} r.0? p.0? - - Unknown - VUS g.135819825_135820081del g.132944438_132944694del - - TSC1_001437 exon 1 deleted; the deletion partially removes the promoter region which is reported between nts. -157bp and -744bp; effect on TSC1 expression unknown - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
-/. _1 c.-278dup r.(?) p.(=) - - Maternal (confirmed) - benign g.135820068dup g.132944681dup - - TSC1_000532 1bp duplication of G upstream of exon 1; reported as polymorphism; HGVS nomenclature = NG_012386.1:g.4957dupG (TSC1) or NG_034227.1:g.4137dupC (GFI1B) unpublished - - Germline - 2/3 individuals tested have the variant BslI+ - - DNA SEQ Blood - TSC - unpublished not-TSC proband and does not have a disease-causing variant; variant also seen in one of the healthy parents; mutation-negative patients were used as controls for testing of this variant and variant seen in another family ? - - - - - - - 2 Rosemary Ekong
-/. _1 c.-278dup r.(?) p.(=) - - Paternal (confirmed) - benign g.135820068dup g.132944681dup - - TSC1_000532 1bp duplication of G upstream of exon 1; reported as polymorphism; found with TSC1 exon 1 deletion; HGVS = NG_012386.1:g.4957dupG (TSC1) or NG_034227.1:g.4137dupC (GFI1B) unpublished - - Germline - 2/3 individuals tested have the variant BslI+ - - DNA MLPA, SEQ Blood - TSC - unpublished proband has both TSC1 variant 5' upstream and de novo TSC1 exon 1 deletion; TSC1 variant 5' upstream also seen in one healthy parent; mutation-negative patients were used as controls for testing TSC1 variant 5' upstream and variant seen in another family ? - - - - - - - 1 Rosemary Ekong
-/- _1 c.-278dup r.(?) p.(=) - - Unknown - benign g.135820068dup g.132944681dup - - TSC1_000532 1bp duplication of G upstream of exon 1; HGVS nomenclature = NG_012386.1:g.4957dup (TSC1) or NG_034227.1:g.4137dupC (GFI1B) - - rs544305928 SUMMARY record - - BslI+ - - - - - - - - - - - - - - - - - - - -
+/. _1_1i c.(?_-234)_(-144+1_-143-1)del r.0? p.0? - - Unknown - pathogenic (dominant) g.(135810483_135819929)_(135820020_?)del - deletion in exon 1 - TSC1_000512 exon 1 deletion seen with TSC1 MLPA P124-B1 kit; breakpoints not determined PubMed: Jang, 2012 - - Unknown - - - - - DNA MLPA Blood - TSC - PubMed: Jang, 2012 25yr old with seizures from 5yrs old; patient has subependymal nodules & multifocal subcortical white matter changes; signs of obsessive-compulsive disorder; family history of facial angiofibromas and seizures in father and uncles; relatives not tested M - Korea, South (Republic) Seoul - - - - 1 Rosemary Ekong
+/. _1_1i c.(?_-234)_(-144+1_-143-1)del r.0? p.0? - - Unknown - pathogenic (dominant) g.(135810483_135819929)_(135820020_?)del - - - TSC1_000512 TSC1 exon 1 and at least 23kb upstream deleted; deletion removes the promoter region reported between nts. -157bp and -744bp unpublished - - De novo - 1/3 individuals tested have the variant - - - DNA MLPA, SEQ Blood - TSC - unpublished proband and one of the parents have the TSC1 missense variant c.3353A>G; proband has a de novo TSC1 5' deletion not seen in parents ? - - - - - - - 1 Rosemary Ekong
+/. _1_1i c.(?_-234)_(-144+1_-143-1)del r.0? p.0? - - Unknown - pathogenic (dominant) g.(135810483_135819929)_(135820020_?)del - c.-234_-144del, exon 1 deleted - TSC1_000512 exon 1 deleted; breakpoints undetermined; found with variant upstream of TSC1 unpublished - - De novo - 1/3 individuals tested have the variant - - - DNA MLPA, SEQ Blood - TSC - unpublished proband has both TSC1 variant 5' upstream and de novo TSC1 exon 1 deletion; TSC1 variant 5' upstream also seen in one healthy parent; mutation-negative patients were used as controls for testing TSC1 variant 5' upstream and variant seen in another family ? - - - - - - - 1 Rosemary Ekong
?/. _1_1i c.(?_-234)_(-144+1_-143-1)del r.0? p.0? - - Unknown - VUS g.(135810483_135819929)_(135820020_?)del - exon 1 del - TSC1_000512 exon 1 deleted; deletion breakpoints unknown; no other potentially pathogenic changes (large or small) seen; the deleted exon 1 MLPA probe is within the promoter region reported between nts. -157bp and -744bp; consequence on gene expression uncertain unpublished - - Unknown - - - - - DNA MLPA, SEQ Blood - TSC - unpublished TS affected; no clinical features indicated; variant reported as of unknown clinical significance F - - - - - - - 1 Rosemary Ekong
+/. _1_1i c.(?_-234)_(-144+1_-143-1)del r.0? p.0? - - Unknown - pathogenic (dominant) g.(135810483_135819929)_(135820020_?)del - deletion exon 1 - TSC1_000512 exon 1 deleted; deletion breakpoints undetermined unpublished - - Unknown - - - - - DNA MLPA Blood - TSC - unpublished No other family member tested F - - - - - - - 1 Rosemary Ekong
+/. _1_1i c.(?_-234)_(-144+1_-143-1)del r.0? p.0? - - Maternal (confirmed) - pathogenic (dominant) g.(135810483_135819929)_(135820020_?)del - deletion exon 1 - TSC1_000512 exon 1 deleted; deletion breakpoints undetermined unpublished - - Germline - 6/8 individuals tested have the variant - - - DNA MLPA Blood - TSC - unpublished affected parent, 2 affected siblings and 2 other ?affected siblings have the same variant; an unaffected sibling and affected parent's half sibling tested negative F - - - - - - - 6 Rosemary Ekong
+/. _1_1i c.(?_-234)_(-144+1_-143-1)del r.0? p.0? - - Unknown - pathogenic (dominant) g.(135810483_135819929)_(135820020_?)del - deletion exon 1 - TSC1_000512 exon 1 deleted; deletion breakpoints undetermined unpublished - - De novo - 1/4 individuals tested have the variant - - - DNA MLPA Blood - TSC - unpublished variant is absent in both parents; an affected distant relative has a different variant (not specified) described as originating from the other side of the family M - - - - - - - 1 Rosemary Ekong
+/. _1_1i c.(?_-234)_(-144+1_-143-1)del r.0? p.0? - - Unknown - pathogenic (dominant) g.(135810483_135819929)_(135820020_?)del - deletion exon 1 - TSC1_000512 exon 1 deleted; deletion breakpoints undetermined unpublished - - Unknown - - - - - DNA MLPA Blood - TSC - unpublished No other family member tested F - - - - - - - 1 Rosemary Ekong
?/? _1_1i c.(?_-234)_(-144+1_-143-1)del r.0? p.0? - - Unknown - VUS g.(135810483_135819929)_(135820020_?)del - - - TSC1_000512 MLPA probe for exon 1 (GAGGGACTGTGA-GGTAAACAGCTG) is at c.-185_-162; promoter region reported between nts. -157bp and -744bp starts in exon 1 and is probably partially deleted, at least. Extent of the deletion and effect on gene expression not determined. - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
+/. _1_1i c.(?_-234)_(-144+1_-143-1)del r.0? p.0? - - Unknown - pathogenic (dominant) g.(135810483_135819929)_(135820020_?)del - - - TSC1_000512 TSC1 exon 1 and at least 23kb upstream deleted; deletion removes the promoter region reported between nts. -157bp and -744bp - - - Germline - - - - - - - - - - - - - - - - - - - - - - -
+/. _1_1i c.(?_-234)_(-144+1_-143-1)del r.? p.? - - Unknown - pathogenic (dominant) g.(135810483_135819929)_(135820020_?)del - exon 1 del - TSC1_000512 deletion involves exon 1 and is predicted to extend into promoter region unpublished - - Germline ? - - - - DNA MLPA Blood - TSC - unpublished TS affected and has 2 affected children; no indication if tested; parents not tested F ? - - - - - - 1 Rosemary Ekong
+/. _1_1i c.(?_-234)_(-144+1_-143-1)dup r.0? p.0? - - Unknown - pathogenic (dominant) g.(135810483_135819929)_(135820020_?)dup - TSC1-E1 amplified - TSC1_000713 TSC1 exon 1 duplicated and breakpoints undetermined; partial dup of promoter region, reported between nts. -157bp and -744bp; TSC2 LOH seen; Oncomap negative PubMed: Qin, 2011 - - Unknown - - - - - DNA MLPA, SEQ Kidney - ? - PubMed: Qin, 2011 44yr old patient; no clinical features of TSC and no other known genetic disease other than features of renal AML M - - - - - - - 1 Rosemary Ekong
?/? _1_1i c.(?_-234)_(-144+1_-143-1)dup r.0? p.0? - - Unknown - VUS g.(135810483_135819929)_(135820020_?)dup - - - TSC1_000713 TSC1 exon 1 duplicated and breakpoints undetermined; partial duplication of promoter region, reported between nts. -157bp and -744bp (i.e. -157_-u510) - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
+/. _1_8i c.(?_-234)_(737+1_738-1)del r.0? p.0? - - Unknown - pathogenic (dominant) g.(135787845_135796749)_(135820020_?)del - deletion exon 1 to 8 - TSC1_000908 exons 1-8 deleted; found with TSC1 intronic variant c.913+8G>C unpublished - - Unknown - 1/2 individuals tested have the variant - - - DNA DHPLC, MLPA, SEQ Blood - TSC - unpublished patient has TSC1 exons 1-8 deletion (c.-234_737+?del) and TSC1 intronic variant c.913+8G>C; TSC1 exons 1-8 deletion is absent in the one parent tested; inheritance of TSC1 c.913+8G>C not indicated M - - - - - - - 1 Rosemary Ekong
+/+ _1_8i c.(?_-234)_(737+1_738-1)del r.0? p.0? - - Unknown - pathogenic (dominant) g.(135787845_135796749)_(135820020_?)del - - - TSC1_000908 exons 1-8 deleted - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
+/. 1i_14i c.(?_-234)_(1438+1_1439-1)del r.0? p.0? - - Unknown - pathogenic (dominant) g.(135781527_135782117)_(135820020_?)del - - - TSC1_000801 exons 1-14 deleted PubMed: Kwiatkowski, 2015 - - Unknown - - - - - DNA SEQ Blood - TSC - PubMed: Kwiatkowski, 2015 patient has TSC with AML ? - - - - - - - 1 Rosemary Ekong
+/+ _1_14i c.(?_-234)_(1438+1_1439-1)del r.0? p.0? - - Unknown - pathogenic (dominant) g.(135781527_135782117)_(135820020_?)del - - - TSC1_000801 exons 1-14 deleted - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
+/. _1_23_ c.(?_-234)_(*4887_?)del r.0? p.0? - - Unknown - pathogenic (dominant) g.(?_135766735)_(135820020_?)del - deletion exon 1 to 23 - TSC1_000170 exons 1-23 deleted unpublished - - Unknown - - - - - DNA MLPA Blood - TSC - unpublished No other family member tested F - - - - - - - 1 Rosemary Ekong
+/. _1_23_ c.(?_-234)_(*4887_?)del r.0? p.0? - - Maternal (confirmed) - pathogenic (dominant) g.(?_135766735)_(135820020_?)del - deletion exon 1 to 23 - TSC1_000170 exons 1-23 deleted; found with TSC2 missense c.1378G>A unpublished - - Germline - 2/8 individuals tested have the variant - - - DNA DHPLC, MLPA, SEQ Blood - TSC - unpublished proband has TSC1 exon 1-23 deletion and TSC2 missense c.1378G>A; the affected parent has both variants; the unnaffected parent and 5 siblings of the affected parent are negative F - - - - - - - 2 Rosemary Ekong
+/. _1_23_ c.(?_-234)_(*4887_?)del r.0? p.0? - - Unknown - pathogenic (dominant) g.(?_135766735)_(135820020_?)del - c.-234-?_*1+?del, del ex.1_ex.23 - TSC1_000170 large deletion; exons 1-23 deleted; variant detected at 50% freq; NGS read depth >500x PubMed: Tyburczy, 2015 - - De novo - 1/3 individuals tested have the variant - - - DNA MLPA Blood - TSC - PubMed: Tyburczy, 2015 26 year old TSC patient with NMI status (previous Sanger SEQ and TSC2 MLPA negative); sporadic case with no FH of TS; both parents tested and variant not found F - - - - - - - 1 Rosemary Ekong
+/+ _1_23_ c.(?_-234)_(*4887_?)del r.0? p.0? - - Unknown - pathogenic (dominant) g.(?_135766735)_(135820020_?)del - - - TSC1_000170 exons 1-23 deleted - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
+/. _1 c.(?_-234)_?del(147000) r.0? p.0? - - Maternal (confirmed) - pathogenic (dominant) g.(?_135766735)_?del(147000) g.(?_132891348)_?del(147000) partial deletion TSC1 - TSC1_001345 reported as 147kb deletion involving part of TSC1, GF11B and GTF3C5; extent of deletion into TSC1 not provided PubMed: Gilboa 2018 - - Germline yes 4/4 individuals tested have the variant - - - DNA arrayCNV Blood CytoScan 750K array used TSC - PubMed: Gilboa 2018 4 affected family members - index, 2 brothers and mother - all have the variant; none met the clinical diagnostic criteria; index had intractable seizures from birth but seizure free after resection; no other TSC features in index F ? Israel - - - - - 4 Rosemary Ekong
?/? _1 c.(?_-234)_?del(147000) r.0? p.0? - - Unknown - VUS g.(?_135766735)_?del(147000) g.(?_132891348)_?del(147000) - - TSC1_001345 147kb deletion involving part of TSC1, GF11B and GTF3C5 (both genes at 5’ of TSC1); deletedTSC1 exons not mentioned and extent of deletion into TSC1 undetermined - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-227G>A r.(?) p.(=) - - Unknown - likely benign g.135820013C>T g.132944626C>T TSC1(NM_000368.5):c.-227G>A - TSC1_001233 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/? 1 c.-227G>A r.(?) p.? - unlikely to affect splicing Unknown - VUS g.135820013C>T g.132944626C>T - - TSC1_001233 - - - rs886063629 SUMMARY record - - BseRI+ - - - - - - - - - - - - - - - - - - - -
+/. 1_1i c.-219_-144+3del r.0? p.0? - - Unknown - pathogenic (dominant) g.135819931_135820009del g.132944544_132944622del exon 1 del, genomic coordinates = 135,819,930-135,820,008 - TSC1_001471 exon 1 deleted; confirmed by qPCR. qPCR result consistent with MLPA unpublished - - Germline ? - - - - DNA MLPA, PCRq Blood - TSC - unpublished parent with epilepsy not tested ? ? - - - - - - 1 Rosemary Ekong
?/? 1_1i c.-219_-144+3del r.0? p.0? - - Unknown - VUS g.135819931_135820009del g.132944544_132944622del - - TSC1_001471 79bp deletion extends from exon 1 to intron 1; deletion extends into the promoter region which starts in exon 1 and is reported to be between nts. -157bp and -744bp; promoter region partially deleted. Effect on gene expression not determined. - - - SUMMARY record - - AluI-, BanI- - - - - - - - - - - - - - - - - - - - -
?/. 1 c.-159G>A r.(?) p.(=) - unlikely to affect splicing Unknown - VUS g.135819945C>T g.132944558C>T - - TSC1_001333 found with TSC2 missense c.3284G>T that affects last base of exon unpublished - - Germline ? - BbvCI-, Bpu10I- - - DNA SEQ-NG Blood - TSC - unpublished clinical features not specified; parents not tested F ? - - - - - - 1 Rosemary Ekong
?/? 1 c.-159G>A r.(?) p.(=) - unlikely to affect splicing Unknown - VUS g.135819945C>T g.132944558C>T - - TSC1_001333 - - - - SUMMARY record - - BbvCI-, Bpu10I- - - - - - - - - - - - - - - - - - - - -
-?/. - c.-144+7A>T r.(=) p.(=) - - Unknown - likely benign g.135819923T>A g.132944536T>A TSC1(NM_000368.5):c.-144+7A>T - TSC1_001315 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/? 1i c.-144+7A>T r.(?) p.(=) - unlikely to affect splicing Unknown - VUS g.135819923T>A g.132944536T>A - - TSC1_001315 - - - rs563924788 SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-144+8T>G r.(=) p.(=) - - Unknown - likely benign g.135819922A>C - TSC1(NM_000368.4):c.-144+8T>G (p.?) - TSC1_001636 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/-? 1i c.-144+1475A>G r.(?) p.(=) - - Unknown - likely benign g.135818455T>C g.132943068T>C - - TSC1_000529 - - - - SUMMARY record - - Hpy188III- - - - - - - - - - - - - - - - - - - - -
-/. 1i c.-144+1530T>G r.(?) p.(=) - - Paternal (confirmed) - benign g.135818400A>C g.132943013A>C I-01 - TSC1_000530 - unpublished - - Germline - 2/3 individuals tested have the variant BsaJI+, BstNI+ - - DNA SEQ Blood - TSC - unpublished seen in proband who does not have any other TSC1 or TSC2 variant; also seen in one healthy parent ? - - - - - - - 2 Rosemary Ekong
-?/-? 1i c.-144+1530T>G r.(?) p.(=) - - Unknown - likely benign g.135818400A>C g.132943013A>C - - TSC1_000530 - - - rs989297207 SUMMARY record - 1/31398 alleles BsaJI+, BstNI+ - - - - - - - - - - - - - - - - - - - -
+/. 1i_23_ c.-144+3172_*67438del r.? p.? - - Unknown - pathogenic (dominant) g.135704184_135816758del g.132828797_132941371del c.-12499_*67438del112575 - TSC1_000488 112575bp deletion starting in intron 1 and including exons 2-23 and 3'UTR; no inserted or inverted nucleotides found PubMed: van den Ouweland, 2011 - - De novo - 1/3 individuals tested have the variant - - - DNA MLPA, PCRq, PCRlr Blood - TSC - PubMed: van den Ouweland, 2011 sporadic case diagnosed with definite TSC at 7yrs; variant not seen in both unaffected parents F - - - - - - - 1 Rosemary Ekong
+/+ 1i_23_ c.-144+3172_*67438del r.? p.? - - Unknown - pathogenic (dominant) g.135704184_135816758del g.132828797_132941371del - - TSC1_000488 112575bp deletion starting in intron 1 and including exons 2-23 and 3'UTR - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
+/. _1_5i c.(?_-143-1)_(363+1_364-1)del r.? p.? - - Unknown - pathogenic (dominant) g.(135798880_135800973)_(135810483_?)del - ex 1-5 del - TSC1_001466 exons 1-5 deleted; 5' end of deletion not determined unpublished - - Germline yes 2/4 individuals tested have the variant - - - DNA MLPA, SEQ-NG-I, SEQ Blood - TSC - unpublished patient with clinical diagnosis of TSC; clinically affected sibling has the variant; both parents tested and variant absent in parents; germline mosaicism not excluded M ? - - - - - - 2 Rosemary Ekong
+/+ _1_5i c.(?_-143-1)_(363+1_364-1)del r.? p.? - - Unknown - pathogenic g.(135798880_135800973)_(135810483_?)del - - - TSC1_001466 exons 1-5 deleted; 5' end of deletion not determined - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
+/. 1i_23_ c.(-144+1_-143-1)_(*4887_?)del r.? p.? - - Unknown - pathogenic (dominant) g.(?_135766735)_(135810483_135819929)del - exon 2-23 del - TSC1_000716 exons 2-23 deleted; consistently reduced level of amplification for exon 2-23; complete screen; MLPA kits P124 (TSC1), P046 (TSC2) unpublished - - Unknown - - - - - DNA MLPA, SEQ Blood - TSC - unpublished no FH of TS; no clinical features reported; indicated as possible somatic mosaic; parents not tested; referred for diagnostic TS testing F - - - - - - - 1 Rosemary Ekong
+/. 1i_23_ c.(-144+1_-143-1)_(*4887_?)del r.? p.? - - Maternal (confirmed) - pathogenic (dominant) g.(?_135766735)_(135810483_135819929)del - exon 2-23 del - TSC1_000716 exons 2-23 deleted; no other potentially pathogenic variant found; complete screen; MLPA kits P124 (TSC1), P046 (TSC2) used unpublished - - Germline - 2/4 individuals tested have the variant - - - DNA MLPA, SEQ Blood - TSC - unpublished index with clinical TS; no clinical features mentioned for index or family members tested; variant arose de novo in a parent of the index as both grandparents of index do not have the variant F - - - - - - - 2 Rosemary Ekong
+/+ 1i_23_ c.(-144+1_-143-1)_(*4887_?)del r.? p.? - - Unknown - pathogenic (dominant) g.(?_135766735)_(135810483_135819929)del - - - TSC1_000716 exons 2-23 deleted - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
-/. 1 c.-131del r.(?) p.(=) - - Unknown - benign g.135810470del g.132935083del TSC1(NM_000368.4):c.-131delT - TSC1_001232 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/-? 2 c.-131del r.(?) p.? - unlikely to affect splicing Unknown - likely benign g.135810470del g.132935083del - - TSC1_001232 1bp deletion of A - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-129A>T r.(?) p.(=) - - Unknown - benign g.135810468T>A g.132935081T>A TSC1(NM_000368.5):c.-129A>T - TSC1_000239 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. 2 c.-129A>T r.(?) p.(=) - - Unknown - benign g.135810468T>A g.132935081T>A c.1-129A>T - TSC1_000239 - PubMed: Au, 2007 - - Unknown - - BpmI+, SexAI- - - DNA SEQ Blood - TSC - PubMed: Au, 2007 - ? - - - - - - - 1 Rosemary Ekong
-/. 2 c.-129A>T r.(?) p.(=) - - Unknown - benign g.135810468T>A g.132935081T>A 93A>T - TSC1_000239 original DNA description off by one; may also be c.-131A>T; variant found with TSC1 variants c.2392-35T>C and c.2425G>C (both in exon 19) PubMed: Dabora, 1998 - - Unknown - - BpmI+, SexAI- - - DNA DGGE Blood - TSC - PubMed: Dabora, 1998 - ? - - - - - - - 1 Rosemary Ekong
-/. 2 c.-129A>T r.(?) p.(=) - - Unknown - benign g.135810468T>A g.132935081T>A - - TSC1_000239 variant in 5'UTR - - rs116951280 Unknown - - BpmI+, SexAI- - - DNA SEQ Blood - Healthy/Control - - variant reported amongst 60 CEU HapMap individuals in 1000Genome phase 1 population ? - - - - - - - 1 Rosemary Ekong
-/. 2 c.-129A>T r.(?) p.(=) - - Unknown - benign g.135810468T>A g.132935081T>A - - TSC1_000239 reported as polymorphism; found with TSC1 missense c.269T>G; variant seen in 10 other families but no other variants reported in these families; a total of 14 heterozygotes seen withthis variant unpublished - - Unknown - 1/5 individuals tested have the variant BpmI+, SexAI- - - DNA DHPLC, SEQ Blood - TSC P53/P54/P55 PubMed: Peron 2018 5 affecteds in 3 generations tested for TSC1 c.269T>G and all 5 patients (including one clinically affected parent and a sibling) have the variant; proband also has TSC1 5'UTR variant c.-129A>T; healthy family members were not tested for any of the TSC1 variants; TSC1 c.-129A>T tested in other patients where no other variant has been reported and TSC1 c.-129A>T seen 14 patients from 10 other families - no healthy relatives in these 10 families were tested for TSC1 c.-129A>T (Migone, personal communication) M ? Italy - - - - - 5 Rosemary Ekong
-/- 2 c.-129A>T r.(?) p.(=) - - Unknown - benign g.135810468T>A g.132935081T>A - - TSC1_000239 - - - rs116951280 SUMMARY record - 419/43980 alleles, 1 homozygotes - - - - - - - - - - - - - - - - - - - - -
-/. - c.-99C>T r.(?) p.(=) - - Unknown - benign g.135810438G>A - TSC1(NM_000368.5):c.-99C>T - TSC1_001566 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-99C>T r.(?) p.(=) - - Unknown - likely benign g.135810438G>A - TSC1(NM_000368.5):c.-99C>T - TSC1_001566 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. 2i c.-80-396A>G r.(?) p.(=) - - Unknown - benign g.135804735T>C g.132929348T>C I-02 - TSC1_000537 common variant in intron 2 unpublished - rs3761840 Unknown - 152/400 individuals tested have the variant - - - DNA SEQ Blood - TSC - unpublished reported hets = 0.38 among patients; mutation-negative patients were used as controls for testing of this variant ? - - - - - - - 152 Rosemary Ekong
-/- 2i c.-80-396A>G r.(?) p.(=) - - Unknown - benign g.135804735T>C g.132929348T>C - - TSC1_000537 common variant in intron 2 - - rs3761840 SUMMARY record - 18687/43822 alleles, 2858 homozygotes - - - - - - - - - - - - - - - - - - - - -
-/- 2i c.-80-55T>C r.(?) p.(=) - - Unknown - benign g.135804394A>G g.132929007A>G - - TSC1_000942 variant in intron 2 - - rs547649950 SUMMARY record - 4/36404 alleles - - - - - - - - - - - - - - - - - - - - -
-/. 2i c.-80-55T>C r.(?) p.(=) - - Paternal (confirmed) - benign g.135804394A>G g.132929007A>G chr9 g.135804394A>G; c.80-55T>C; intron 3 - TSC1_000942 variant in intron 2; validated by Sanger SEQ PubMed: Nellist, 2015 - rs547649950 Germline - 2/3 individuals tested have the variant - - - DNA, RNA SEQ-NG-I, SEQ Blood, Skin fibroblast - TSC I PubMed: Nellist, 2015 13 yr old NMI patient; diagnosed at 0 yr; both parents clinically examined and no signs of TSC found; all variants inherited from mother except TSC1 variant reported as c.80-55T>C which is inherited from the father ? - - - - - - - 2 Rosemary Ekong
-/. 2i c.-80-51del r.(?) p.(=) - - Unknown - benign g.135804396del g.132929009del c.-131delT, intron 2 - TSC1_000608 1bp deletion of T; deleted base is in bracket and CAPITAL - cttgcaggtattttctttttt(T)atggagaaaaatggggccatttag PubMed: Sancak, 2005 - - Unknown - - - - - DNA SEQ Blood - TSC - PubMed: Sancak, 2005 - ? - - - - - - - 1 Rosemary Ekong
?/? 2i c.-80-51del r.(?) p.(=) - - Unknown - VUS g.135804396del g.132929009del - - TSC1_000608 5'UTR variant; 1bp deletion of T; deleted base is in bracket and CAPITAL - cttgcaggtattttctttttt(T)atggagaaaaatggggccatttag - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
+/. 2i_8i c.(-81+1_-80-1)_(737+1_738-1)del r.? p.? - - Unknown - pathogenic (dominant) g.(135787845_135796749)_(135804340_135810419)del - exons 3-8 deleted - TSC1_000782 exons 3-8 deleted; reported as disease-associated mutation; entire TSC1 and TSC2 genes sequenced; TSC1/TSC2 MLPA done; TSC1 deletion detected unpublished - - De novo - 1/3 individuals tested have the variant - - - DNA MLPA, SEQ Blood - TSC - unpublished sporadic case; TS affected; both parents reported as unaffected and tested; variant absent in both parents M - - - - - - - 1 Rosemary Ekong
+?/+? 2i_8i c.(-81+1_-80-1)_(737+1_738-1)del r.? p.? - - Unknown - likely pathogenic (dominant) g.(135787845_135796749)_(135804340_135810419)del - - - TSC1_000782 exons 3-8 deleted - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
+/. 2i_14i c.(-81+1_-80-1)_(1438+1_1439-1)del r.(?) p.? - - Unknown - pathogenic (dominant) g.(135804340_135810419)_(135781527_135782117)del g.(132928953_132935032)_(132906140_132906730)del NG_012386.1 (NM_000368.4): c.-(81+1_-80-1)_(1438-1_1439+1)del, exon 1 - TSC1_001346 exons 3-14 deleted PubMed: Peron 2018 - - Germline ? - - - - DNA MLPA Blood - TSC P223 PubMed: Peron 2018 parents reported as unaffected and not tested F ? Italy - - - - - 1 Rosemary Ekong
+/+ 2i_14i c.(-81+1_-80-1)_(1438+1_1439-1)del r.(?) p.? - - Unknown - pathogenic (dominant) g.(135804340_135810419)_(135781527_135782117)del g.(132928953_132935032)_(132906140_132906730)del - - TSC1_001346 exons 3-14 deleted - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
+/. 2i_23_ c.(-81+1_-80-1)_(*4887_?)del r.? p.? - - Maternal (confirmed) - pathogenic (dominant) g.(?_135766735)_(135804340_135810419)del - exons 3-23 deleted - TSC1_000718 TSC1 3-23 deleted; found with TSC2 variant c.4959C>T; complete screen; MLPA kits P124 (TSC1), P046 (TSC2) used unpublished - - Germline - 3/3 individuals tested have the variant - - - DNA MLPA, SEQ Blood - TSC - unpublished index has TSC1 exon 3-23 deletion and TSC2 c.4959C>T; TSC1 deletion also found in affected parent and one affected sibling tested; an apparently unaffected sibling (not fully examined) and a possibly affected sibling were not tested M - - - - - - - 3 Rosemary Ekong
+/+ 2i_23_ c.(-81+1_-80-1)_(*4887_?)del r.? p.? - - Unknown - pathogenic (dominant) g.(?_135766735)_(135804340_135810419)del - - - TSC1_000718 TSC1 3-23 deleted - - - SUMMARY record - - - - - - - - - - - - - - - - - - - - - - -
?/? 3 c.-44G>A r.(?) p.(=) - - Unknown - VUS g.135804303C>T g.132928916C>T - - TSC1_000541 - - - rs773447503 SUMMARY record - 7/249052 alleles - - - - - - - - - - - - - - - - - - - - -
-?/. 3 c.-44G>A r.(?) p.(=) - - Unknown - likely benign g.135804303C>T g.132928916C>T - - TSC1_000541 reported as probable polymorphism unpublished - rs773447503 Unknown - - AlwNI-, LpnPI- - - DNA SEQ Blood - TSC - unpublished reported that proband with this variant does not have a definite pathogenic variant found; parents not tested for variant ? - - - - - - - 1 Rosemary Ekong
-/- 3 c.-16G>A r.(?) p.(=) - - Unknown - benign g.135804275C>T g.132928888C>T - - TSC1_000538 - - - rs114970627 SUMMARY record - 18/282996 alleles - - - - - - - - - - - - - - - - - - - - -
-/. 3 c.-16G>A r.(?) p.(=) - - Unknown - benign g.135804275C>T g.132928888C>T - - TSC1_000538 5'UTR variant reported as polymorphism; found with TSC2 splice variant c.5252_5259+19del unpublished - rs114970627 Unknown - - HaeII-, HhaI- - - DNA, RNA SEQ Blood - TSC - unpublished proband has TSC1 5'UTR variant c.-16G>A and TSC2 splice variant c.5252_5259+19del; parents not tested; intron 40 sequence inserted = CTCAGCGGGGTGTGCTGGCTGCCCAAGCTGTGGGGCGGGTGTGTGGGCAGAGCGGTTGCCACGCCTCCCAGACTTACTGCCCAAGCCGCCTCTGCCTTCAG; amino acids inserted = QRGVLAAQAVGRVCGQSGCHASQTYCPSRLCLQ ? - - - - - - - 1 Rosemary Ekong
-?/. - c.-7C>T r.(?) p.(=) - - Unknown - likely benign g.135804266G>A g.132928879G>A TSC1(NM_000368.4):c.-7C>T, TSC1(NM_000368.5):c.-7C>T - TSC1_000240 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-7C>T r.(?) p.(=) - - Unknown - likely benign g.135804266G>A g.132928879G>A TSC1(NM_000368.4):c.-7C>T, TSC1(NM_000368.5):c.-7C>T - TSC1_000240 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.-7C>T r.(?) p.(=) - - Unknown - benign g.135804266G>A g.132928879G>A TSC1(NM_000368.4):c.-7C>T, TSC1(NM_000368.5):c.-7C>T - TSC1_000240 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. 3 c.-7C>T r.(?) p.(=) - - Unknown - benign g.135804266G>A g.132928879G>A c.1-7C>T - TSC1_000240 - PubMed: Au, 2007 - - Unknown - - - - - DNA SEQ Blood - TSC - PubMed: Au, 2007 - ? - - - - - - - 1 Rosemary Ekong
-/. 3 c.-7C>T r.(?) p.(=) - - Unknown - benign g.135804266G>A g.132928879G>A 215C>T - TSC1_000240 rare variant in 5'UTR; seen in 1 patient; sequencing of RT-PCR revealed both alleles expressed; no effect on splicing seen; not seen in 50 CEPH controls PubMed: Niida, 1999 - - Unknown - 1/162 individuals tested have the variant - - - RNA RT-PCR, SSCA Blood - TSC - PubMed: Niida, 1999 parents unavailable for testing ? - - - - - - - 1 Rosemary Ekong
?/. 3 c.-7C>T r.(?) p.(=) - - Unknown - VUS g.135804266G>A g.132928879G>A c.1-7C>T - TSC1_000240 7th base in 5'UTR; found with TSC1 nonsense variant c.2698C>T; small and large changes screened; MLPA kits P124 (TSC1) & P046 (TSC2) used unpublished - - Unknown - 1/2 individuals tested have the variant - - - DNA MLPA, SEQ Blood - TSC - unpublished possible family history of TS, but not formally diagnosed; one parent available for testing has subtle TS features (not specified) and has the TSC1 nonsense variant c.2698C>T; this parent was not tested for TSC1 c.-7C>T M - - - - - - - 2 Rosemary Ekong
Legend   How to query   « First ‹ Prev     1 2 3 4 5 6 7 8 9 10 11 ...     Next › Last »

Assessment of functional consequences - Our conclusions on the functional consequences of variants are based on the type of variant, results of in vitro functional tests (doi: 10.1002/humu.21451; doi: 10.1002/humu.22202; doi: 10.1002/humu.23963), population frequencies, output from in silico splice site prediction algorithms, and any clinical/family data available to us. We also have output from protein prediction programs in this database for comparison purposes and they are not considered in our assessment of pathogenicity. PolyPhen Predictions - Note that these results are from PolyPhen-2 and only the HumDiv classification is shown.


Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.