Full data view for gene TSC1

The curator’s expert opinion on the classification of a variant, can be found in the
SUMMARY record. Regarding the classification, please note that where there are several
records of the same variant, the classification of that variant may differ depending on the
submitter’s conclusion.

The variants shown are described using the NM_000368.4 transcript reference sequence.

Legend

Please note that a short description of a certain column can be displayed when you move your mouse cursor over the column's header and hold it still. Below, a more detailed description is shown per column.

Effect: The variant's effect on the function of the gene/protein, displayed in the format 'R/C'. R is the value reported by the source (publication, submitter) and this classification may vary between records. C is the value concluded by the curator. Note that in some database the curator uses Summary records to give details on the classification of the variant.Values used: '+' indicating the variant affects function, '+?' probably affects function, '-' does not affect function, '-?' probably does not affect function, '?' effect unknown, '.' effect was not classified.

Exon: number of exon/intron containing variant; 2 = exon 2, 12i = intron 12, 2i_7i = from intron 2 to intron 7, 8i_9 = intron 8/exon 9 boundary, _1 = 5' to exon 1, 18_ = 3' of exon 18, _1_18_ = encompassing the entire 18-exon gene

DNA change (cDNA): description of variant at DNA level, based on a coding DNA reference sequence (following HGVS recommendations); e.g. c.123C>T, c.123_145del, c.123_126dup. For deletions/duplications extending beyond the reference transcript resp. {0}/{2} is used to replace del/dup. Extent of the deletion/duplication should be specified using the genomic description (g.). "-" indicates the variant described on genomic level does not affect the coding DNA reference sequence.

RNA change: description of variant at RNA level (following HGVS recommendations).

r.123c>u
r.? = unknown
r.(?) = RNA not analysed but probably transcribed copy of DNA variant
r.spl? = RNA not analysed but variant probably affects splicing
r.(spl?) = RNA not analysed but variant may affect splicing
r.0? = change expected to abolish transcription

Protein: description of variant at protein level (following HGVS recommendations).

p.(Arg345Pro) = change predicted from DNA (RNA not analysed)
p.Arg345Pro = change derived from RNA analysis
p.? = unknown effect
p.0? = probably no protein produced

P-domain: region/domain protein affected

Predict-BioInf: predicted effect of variant using bioinformatic analysis tools (e.g. AGVGD, CADD, conservation, Grantham, MutationTaster, PolyPhen, REVEL, SIFT, splicing, etc.)

Allele: On which allele is the variant located? Does not necessarily imply inheritance! 'Paternal' (confirmed or inferred), 'Maternal' (confirmed or inferred), 'Parent #1' or #2 for compound heterozygosity without having screened the parents, 'Unknown' for heterozygosity without having screened the parents, 'Both' for homozygozity.

Classification method: The method used for the clinical classification of this variant.
All options:

ACMG
ACGS
EAHAD-CFDB
ENIGMA
IARC
InSiGHT
kConFab
other

Clinical classification: Clinical classification of variant, preferably based on standardised criteria (e.g. ACMG), directed on the clinical consequences as published/submitted, indicated using an enriched system including inheritance: e.g. pathogenic, pathogenic (dominant), pathogenic (recessive), pathogenic (!), pathogenic (maternal), pathogenic (paternal). Standard inheritance is covered by dominant/recessive, imprinting by maternal/paternal. A '!' warns for exceptional circumstances to be explained in the 'Remarks' field (low penetrance, variants pathogenic in heterozygous state only, hypomorphic/hypermorphic variants, protective variants, etc.). Non-disease consequences (e.g. drug metabolism (pharmacogenetics), risk factor, blood group, tasting bitter) are indicated using additions to the benign classification; benign (dominant), benign (recessive), benign (!), etc. The value 'association' is used for variants associated with a phenotype and 'NA' for variants from in vitro/in silico records. NOTE: classification may differ from the opinion of the curator as given in a variant SUMMARY-record or the 'Functional effect concluded'). NOTE: pathogenic/likely pathogenic should go together with "variant (probably) affects function" In ClassFunctional.
All options:

pathogenic
pathogenic (dominant)
pathogenic (recessive)
pathogenic (!)
pathogenic (maternal)
pathogenic (paternal)
likely pathogenic
likely pathogenic (dominant)
likely pathogenic (recessive)
likely pathogenic (!)
likely pathogenic (maternal)
likely pathogenic (paternal)
VUS
VUS (!)
likely benign
likely benign (dominant)
likely benign (recessive)
likely benign (!)
likely benign (maternal)
likely benign (paternal)
benign
benign (dominant)
benign (recessive)
benign (!)
benign (maternal)
benign (paternal)
conflicting
association
NA

DNA change (genomic) (hg19): HGVS description of variant at DNA level, based on the genomic (chromosomal) DNA reference sequence; e.g. g.12345678C>T, g.12345679del, g.12345678_12345890dup

DNA change (hg38): HGVS description of variant at DNA level, based on the hg38 genomic (chromosomal) eference sequence; e.g. g.12345678C>T, g.12345679del, g.12345678_12345890dup

Published as: listed only when different from "DNA change"; variant as reported originally (e.g. 521delT). Variants seen in animal models, tested in vitro, predicted from RNA analysis, etc. are described between brackets like c.(456C>G)

ISCN: description of the variant according to ISCN nomenclature

DB-ID: database ID of variant, grouping multiple observations of the same variant together, starting with the HGNC gene symbol, followed by an underscore (_) and a six digit number (e.g. DMD_012345). _000000 is used for variants where DNA was not analysed (change predicted from RNA analysis), variants seen in animal models or variants not seen in humans but functionally tested in vitro

Variant remarks: remarks regarding variant described, e.g. germline mosaicism in mother, 345 kb deletion, muscle RNA analysed, not in 200 control chromosomes tested, on founder haplotype, etc.

Reference: publication describing the variant submitted, incl. links to OMIM, PubMed or other source, e.g. "den Dunnen ASHG2003 P2346"

ClinVar ID: ID of variant in ClinVar database

dbSNP ID: the dbSNP ID

Origin: Origin of variant/record: Germline = in all cells, De novo = in all cells, but not in either parent, Germline/De novo (untested) = in all cells, parents not tested (use only when De novo is likely, e.g. isolated/sporadic cases with dominant disease), Somatic = present in a subset of cells, but not in either parent, Uniparental disomy = from parental disomy (maternal or paternal), CLASSIFICATION record = submitter only sharing variant classification (note another report may share Individual data), SUMMARY record = master summary record from curator (may link to another database), In vitro (cloned) = data resulting from in vitro functional assays, animal model = data from animal model, Artefact = false positive variant call, DUPLICATE record = variant already described on another chromosome (e.g. unbalanced translocation, duplicating transposition, 2nd fusion transcript, etc.)
All options:

Germline
De novo
Germline/De novo (untested)
Somatic
Uniparental disomy
Uniparental disomy, maternal allele
Uniparental disomy, paternal allele
CLASSIFICATION record
SUMMARY record
In vitro (cloned)
In silico
animal model
Artefact
DUPLICATE record
Unknown
Not applicable

Segregation: Indicates whether the variant segregates with the phenotype (yes), does not segregate with the phenotype (no) or segregation is unknown (?)
All options:

? = unknown
yes = segregates with phenotype
no = does not segregate with phenotype
- = not applicable

Frequency: frequency in which the variant was found; e.g 5/760 chromosomes (in 5 of 760 chromosomes tested), 1/33 patients (in 1 of 33 patients analysed in study), 0.05 controls (in 5% of control cases tested)

Re-site: restriction enzyme recognition site created (+) or destroyed (-); e.g. BglII+;BamHI-

VIP: variant VIP-status was requested for matchmaking - need collaboration(s) to crack the case - please contact the submitter/curator. NOTE: to get VIP status ask the curator.

Methylation: result of methylation test; GOM (gain of methylation), LOM (loss of methylation), 30% (30% methylated). NOTE: when several tests were done mention the method as well (e.g. MS-PCR 75%)

Template: Template(s) used to detect the sequence variant; DNA (genomic DNA), RNA (cDNA) or protein
All options:

DNA
RNA = RNA (cDNA)
protein
? = unknown

Technique: technique(s) used to identify the sequence variant.
All options:

? = unknown
ARMS = amplification refractory mutation system
arrayCGH = array for Comparative Genomic Hybridisation
arrayMET = array for methylation analysis
arraySEQ = array for resequencing
arraySNP = array for SNP typing
arrayCNV = array for Copy Number Variation (SNP and CNV probes)
ASO = allele-specific oligo hybridisation
BESS = Base Excision Sequence Scanning
CMC = Chemical Mismatch Cleavage
COBRA = Combined Bisulfite Restriction Analysis
CSCE = Conformation Sensitive Capillary Electrophoresis
CSGE = Conformation Sensitive Gel Electrophoresis
ddF = dideoxy Fingerprinting
DGGE = Denaturing-Gradient Gel-Electrophoresis
DHPLC = Denaturing High-Performance Liquid Chromatography
DOVAM = Detection Of Virtually All Mutations (SSCA variant)
DSCA = Double-Strand DNA Conformation Analysis
DSDI = Detection Small Deletions and Insertions
EMC = Enzymatic Mismatch Cleavage
expr = expression analysis
FISH = Fluorescent In-Situ Hybridisation
FISHf = fiberFISH
HD = HeteroDuplex analysis
HPLC = High-Performance Liquid Chromatography
IEF = IsoElectric Focussing
IHC = Immuno-Histo-Chemistry
Invader = Invader assay
MAPH = Multiplex Amplifiable Probe Hybridisation
MAQ = Multiplex Amplicon Quantification
MCA = Melting Curve Analysis, high-resolution (HRMA)
microscope = microscopic analysis (karyotype)
microsat = microsatellite genotyping
minigene = expression minigene construct
MIP = Molecular Inversion Probe amplification
MIPsm = single molecule Molecular Inversion Probe amplification
MLPA = Multiplex Ligation-dependent Probe Amplification
MLPA-ms = Multiplex Ligation-dependent Probe Amplification, methylation specific
MS = mass spectrometry
Northern = Northern blotting
NUC = nuclease digestion (RNAseT1, S1)
OM = optical mapping
PAGE = Poly-Acrylamide Gel-Electrophoresis
PCR = Polymerase Chain Reaction
PCRdd = PCR, digital droplet
PCRdig = PCR + restriction enzyme digestion
PCRh = PCR, haloplex
PCRlr = PCR, long-range
PCRm = PCR, multiplex
PCRms = PCR, methylation sensitive
PCRq = PCR, quantitative (qPCR)
PCRrp = PCR, repeat-primed (RP-PCR)
PCRsqd = PCR, semi-quantitative duplex
PE = primer extension (APEX, SNaPshot)
PEms = primer extension, methylation-sensitive single-nucleotide
PFGE = Pulsed-Field Gel-Electrophoresis (+Southern)
PTT = Protein Truncation Test
RFLP = Restriction Fragment Length Polymorphisms
RT-PCR = Reverse Transcription and PCR
RT-PCRq = Reverse Transcription and PCR, quantitative
SBE = Single Base Extension
SEQ = SEQuencing (Sanger)
SEQb = bisulfite SEQuencing
SEQp = pyroSequencing
SEQms = sequencing, methylation specific
SEQ-ON = next-generation sequencing - Oxford Nanopore
SEQ-NG = next-generation sequencing
SEQ-NG-RNA = next-generation sequencing RNA
SEQ-NG-H = next-generation sequencing - Helicos
SEQ-NG-I = next-generation sequencing - Illumina/Solexa
SEQ-NG-IT = next-generation sequencing - Ion Torrent
SEQ-NG-R = next-generation sequencing - Roche/454
SEQ-NG-S = next-generation sequencing - SOLiD
SEQ-PB = next-generation sequencing - Pacific Biosciences
SNPlex = SNPlex
Southern = Southern blotting
SSCA = Single-Strand DNA Conformation polymorphism Analysis (SSCP)
SSCAf = fluorescent SSCA (SSCP)
STR = Short Tandem Repeat
TaqMan = TaqMan assay
Western = Western blotting
- = not applicable

Tissue: tissue type used for analysis

Remarks: remarks regarding the screening like WGS (whole genome sequencing), WES (whole exome sequencing, gene panel (incl. a list of genes analysed), etc.

ID_report: ID of the individual that can be publically shared, e.g. as listed in a publication

Reference: reference to publication describing the individual/family, possibly giving more phenotypic details than listed in this database entry, incl. link to PubMed or other source, e.g. "den Dunnen ASHG2003 P2346"

Remarks: remarks about the individual

Gender: gender individual
All options:

? = unknown
- = not applicable
F = female
M = male
rF = raised as female
rM = raised as male

Consanguinity: indicates whether the parents are related (consanguineous), not related (non-consanguineous) or whether consanguinity is not known (unknown)
All options:

no = non-consanguineous parents
yes = consanguineous parents
likely = consanguinity likely
? = unknown
- = not applicable

Country: where (country) does the individual live/recently came from. Give additional details (population, specific sub-group) and when parents come from different countries in "Population". Belgium = individual lives in/recently came from Belgium, (France) = reported by laboratory in France, individual's country of origin not sure
All options:

? (unknown)
- (not applicable)
Afghanistan
(Afghanistan)
Albania
(Albania)
Algeria
(Algeria)
American Samoa
(American Samoa)
Andorra
(Andorra)
Angola
(Angola)
Anguilla
(Anguilla)
Antarctica
(Antarctica)
Antigua and Barbuda
(Antigua and Barbuda)
Argentina
(Argentina)
Armenia
(Armenia)
Aruba
(Aruba)
Australia
(Australia)
Austria
(Austria)
Azerbaijan
(Azerbaijan)
Bahamas
(Bahamas)
Bahrain
(Bahrain)
Bangladesh
(Bangladesh)
Barbados
(Barbados)
Belarus
(Belarus)
Belgium
(Belgium)
Belize
(Belize)
Benin
(Benin)
Bermuda
(Bermuda)
Bhutan
(Bhutan)
Bolivia
(Bolivia)
Bosnia and Herzegovina
(Bosnia and Herzegovina)
Botswana
(Botswana)
Bouvet Island
(Bouvet Island)
Brazil
(Brazil)
British Indian Ocean Territory
(British Indian Ocean Territory)
Brunei Darussalam
(Brunei Darussalam)
Bulgaria
(Bulgaria)
Burkina Faso
(Burkina Faso)
Burundi
(Burundi)
Cambodia
(Cambodia)
Cameroon
(Cameroon)
Canada
(Canada)
Cape Verde
(Cape Verde)
Cayman Islands
(Cayman Islands)
Central African Republic
(Central African Republic)
Central Europe
Chad
(Chad)
Chile
(Chile)
China
(China)
Christmas Island
(Christmas Island)
Cocos (Keeling Islands)
(Cocos (Keeling Islands))
Colombia
(Colombia)
Comoros
(Comoros)
Congo
(Congo)
Cook Islands
(Cook Islands)
Costa Rica
(Costa Rica)
Cote D'Ivoire (Ivory Coast)
(Cote D'Ivoire (Ivory Coast))
Croatia (Hrvatska)
(Croatia (Hrvatska))
Cuba
(Cuba)
Cyprus
(Cyprus)
Czech Republic
(Czech Republic)
Denmark
(Denmark)
Djibouti
(Djibouti)
Dominica
(Dominica)
Dominican Republic
(Dominican Republic)
East Timor
(East Timor)
Ecuador
(Ecuador)
Egypt
(Egypt)
El Salvador
(El Salvador)
England
(England)
Equatorial Guinea
(Equatorial Guinea)
Eritrea
(Eritrea)
Estonia
(Estonia)
Ethiopia
(Ethiopia)
Falkland Islands (Malvinas)
(Falkland Islands (Malvinas))
Faroe Islands
(Faroe Islands)
Fiji
(Fiji)
Finland
(Finland)
France
(France)
Gabon
(Gabon)
Gambia
(Gambia)
Georgia
(Georgia)
Germany
(Germany)
Ghana
(Ghana)
Gibraltar
(Gibraltar)
Greece
(Greece)
Greenland
(Greenland)
Grenada
(Grenada)
Guadeloupe
(Guadeloupe)
Guam
(Guam)
Guatemala
(Guatemala)
Guiana, French
(Guiana, French)
Guinea
(Guinea)
Guinea-Bissau
(Guinea-Bissau)
Guyana
(Guyana)
Haiti
(Haiti)
Heard and McDonald Islands
(Heard and McDonald Islands)
Honduras
(Honduras)
Hong Kong
(Hong Kong)
Hungary
(Hungary)
Iceland
(Iceland)
India
(India)
Indonesia
(Indonesia)
Iran
(Iran)
Iraq
(Iraq)
Ireland
(Ireland)
Israel
(Israel)
Italy
(Italy)
Jamaica
(Jamaica)
Japan
(Japan)
Jordan
(Jordan)
Kazakhstan
(Kazakhstan)
Kenya
(Kenya)
Kiribati
(Kiribati)
Korea
(Korea)
Korea, North (People's Republic)
(Korea, North (People's Republic))
Korea, South (Republic)
(Korea, South (Republic))
Kosovo
(Kosovo)
Kuwait
(Kuwait)
Kyrgyzstan (Kyrgyz Republic)
(Kyrgyzstan (Kyrgyz Republic))
Laos
(Laos)
Latvia
(Latvia)
Lebanon
(Lebanon)
Lesotho
(Lesotho)
Liberia
(Liberia)
Libya
(Libya)
Liechtenstein
(Liechtenstein)
Lithuania
(Lithuania)
Luxembourg
(Luxembourg)
Macau
(Macau)
Macedonia
(Macedonia)
Madagascar
(Madagascar)
Malawi
(Malawi)
Malaysia
(Malaysia)
Maldives
(Maldives)
Mali
(Mali)
Mallorca
(Mallorca)
Malta
(Malta)
Marshall Islands
(Marshall Islands)
Martinique
(Martinique)
Mauritania
(Mauritania)
Mauritius
(Mauritius)
Mayotte
(Mayotte)
Mexico
(Mexico)
Micronesia
(Micronesia)
Moldova
(Moldova)
Monaco
(Monaco)
Mongolia
(Mongolia)
Montserrat
(Montserrat)
Morocco
(Morocco)
Mozambique
(Mozambique)
Myanmar
(Myanmar)
Namibia
(Namibia)
Nauru
(Nauru)
Nepal
(Nepal)
Netherlands
(Netherlands)
Netherlands Antilles
(Netherlands Antilles)
Neutral Zone (Saudia Arabia/Iraq)
(Neutral Zone (Saudia Arabia/Iraq))
New Caledonia
(New Caledonia)
New Zealand
(New Zealand)
Nicaragua
(Nicaragua)
Niger
(Niger)
Nigeria
(Nigeria)
Niue
(Niue)
Norfolk Island
(Norfolk Island)
Northern Ireland
(Northern Ireland)
Northern Mariana Islands
(Northern Mariana Islands)
Norway
(Norway)
Oman
(Oman)
Pakistan
(Pakistan)
Palau
(Palau)
Palestine
(Palestine)
Panama
(Panama)
Papua New Guinea
(Papua New Guinea)
Paraguay
(Paraguay)
Peru
(Peru)
Philippines
(Philippines)
Pitcairn
(Pitcairn)
Poland
(Poland)
Polynesia, French
(Polynesia, French)
Portugal
(Portugal)
Puerto Rico
(Puerto Rico)
Qatar
(Qatar)
Reunion
(Reunion)
Romania
(Romania)
Russia
(Russia)
Russian Federation
(Russian Federation)
Rwanda
(Rwanda)
S. Georgia and S. Sandwich Isls.
(S. Georgia and S. Sandwich Isls.)
Saint Kitts and Nevis
(Saint Kitts and Nevis)
Saint Lucia
(Saint Lucia)
Saint Vincent and The Grenadines
(Saint Vincent and The Grenadines)
Samoa
(Samoa)
San Marino
(San Marino)
Sao Tome and Principe
(Sao Tome and Principe)
Saudi Arabia
(Saudi Arabia)
Scotland
(Scotland)
Senegal
(Senegal)
Serbia
(Serbia)
Seychelles
(Seychelles)
Sierra Leone
(Sierra Leone)
Singapore
(Singapore)
Slovakia (Slovak Republic)
(Slovakia (Slovak Republic))
Slovenia
(Slovenia)
Solomon Islands
(Solomon Islands)
Somalia
(Somalia)
South Africa
(South Africa)
Southern Territories, French
(Southern Territories, French)
Soviet Union (former)
(Soviet Union (former))
Spain
(Spain)
Sri Lanka
(Sri Lanka)
St. Helena, Ascension and Tristan da
Cunha
(St. Helena, Ascension and Tristan da
Cunha)
St. Pierre and Miquelon
(St. Pierre and Miquelon)
Sudan
(Sudan)
Sudan, South
(Sudan, South)
Suriname
(Suriname)
Svalbard and Jan Mayen Islands
(Svalbard and Jan Mayen Islands)
Swaziland
(Swaziland)
Sweden
(Sweden)
Switzerland
(Switzerland)
Syria
(Syria)
Taiwan
(Taiwan)
Tajikistan
(Tajikistan)
Tanzania
(Tanzania)
Thailand
(Thailand)
Togo
(Togo)
Tokelau
(Tokelau)
Tonga
(Tonga)
Trinidad and Tobago
(Trinidad and Tobago)
Tunisia
(Tunisia)
Turkey
(Turkey)
Turkmenistan
(Turkmenistan)
Turks and Caicos Islands
(Turks and Caicos Islands)
Tuvalu
(Tuvalu)
Uganda
(Uganda)
Ukraine
(Ukraine)
United Arab Emirates
(United Arab Emirates)
United Kingdom (Great Britain)
(United Kingdom (Great Britain))
United States
(United States)
Uruguay
(Uruguay)
US Minor Outlying Islands
(US Minor Outlying Islands)
Uzbekistan
(Uzbekistan)
Vanuatu
(Vanuatu)
Vatican City State (Holy See)
(Vatican City State (Holy See))
Venezuela
(Venezuela)
Viet Nam
(Viet Nam)
Virgin Islands (British)
(Virgin Islands (British))
Virgin Islands (US)
(Virgin Islands (US))
Wales
(Wales)
Wallis and Futuna Islands
(Wallis and Futuna Islands)
Western Sahara
(Western Sahara)
Yemen
(Yemen)
Yugoslavia
(Yugoslavia)
Zaire
(Zaire)
Zambia
(Zambia)
Zimbabwe
(Zimbabwe)

Population: population the individual (or ancestors) belongs to; e.g. white, gypsy, Jewish-Ashkenazi, Africa-N, Sardinia, etc.

Age at death: age at which the individual deceased (when applicable):

35y = 35 years
>43y = still alive at 43y
04y08m = 4 years and 8 months
00y00m01d12h = 1 day and 12 hours
18y? = around 18 years
30y-40y = between 30 and 40 years
>54y = older than 54
? = unknown

VIP: individual/phenotype VIP-status was requested for matchmaking - need collaboration(s) to crack the case - please contact the submitter/curator. NOTE: to get VIP status ask the curator.

Data_av: are additional data available upon request: e.g. pedigree (yes/no/?)

Treatment: treatment of patient

How to query this table

All list views have search fields which can be used to search data. You can search for a complete word or you can search for a part of a search term. If you enclose two or more words in double quotes, LOVD will search for the combination of those words only exactly in the order you specify. Note that search terms are case-insensitive and that wildcards such as * are treated as normal text! For all options, like "and", "or", and "not" searches, or searching for prefixes or suffixes, see the table below.

Operator	Column type	Example	Matches
	Text	Arg	all entries containing 'Arg'
space	Text	Arg Ser	all entries containing 'Arg' and 'Ser'
\|	Text	Arg\|Ser	all entries containing 'Arg' or 'Ser'
!	Text	!fs	all entries not containing 'fs'
^	Text	^p.(Arg	all entries beginning with 'p.(Arg'
$	Text	Ser)$	all entries ending with 'Ser)'
=""	Text	=""	all entries with this field empty
=""	Text	="p.0"	all entries exactly matching 'p.0'
!=""	Text	!=""	all entries with this field not empty
!=""	Text	!="p.0"	all entries not exactly matching 'p.0?'
combination	Text	*\|Ter !fs	all entries containing '*' or 'Ter' but not containing 'fs'
	Date	2020	all entries matching the year 2020
\|	Date	2020-03\|2020-04	all entries matching March or April, 2020
!	Date	!2020-03	all entries not matching March, 2020
<	Date	<2020	all entries before the year 2020
<=	Date	<=2020-06	all entries in or before June, 2020
>	Date	>2020-06	all entries after June, 2020
>=	Date	>=2020-06-15	all entries on or after June 15th, 2020
combination	Date	2019\|2020 <2020-03	all entries in 2019 or 2020, and before March, 2020
	Numeric	23	all entries exactly matching 23
\|	Numeric	23\|24	all entries exactly matching 23 or 24
!	Numeric	!23	all entries not exactly matching 23
<	Numeric	<23	all entries lower than 23
<=	Numeric	<=23	all entries lower than, or equal to, 23
>	Numeric	>23	all entries higher than 23
>=	Numeric	>=23	all entries higher than, or equal to, 23
combination	Numeric	>=20 <30 !23	all entries with values from 20 to 29, but not equal to 23

Some more advanced examples:

Example	Matches
Asian	all entries containing 'Asian', 'asian', including 'Caucasian', 'caucasian', etc.
Asian !Caucasian	all entries containing 'Asian' but not containing 'Caucasian'
Asian\|African !Caucasian	all entries containing 'Asian' or 'African', but not containing 'Caucasian'
"South Asian"	all entries containing 'South Asian', but not containing 'South East Asian'

To sort on a certain column, click on the column header or on the arrows. If that column is already selected to sort on, the sort order will be swapped. The column currently sorted on has a darker blue background color than the other columns. The up and down arrows next to the column name indicate the current sorting direction. When sorting on any field other than the default, LOVD will sort secondarily on the default sort column.

4708 entries on 48 pages. Showing entries 1 - 100.

	Legend	How to query	« First	‹ Prev		1	2	3	4	5	6	7	8	9	10	11	...		Next ›	Last »

Effect	Exon	DNA change (cDNA)	RNA change	Protein	P-domain	Predict-BioInf	Allele	Classification method	Clinical classification	DNA change (genomic) (hg19)	DNA change (hg38)	Published as	ISCN	DB-ID	Variant remarks	Reference	ClinVar ID	dbSNP ID	Origin	Segregation	Frequency	Re-site	VIP	Methylation	Template	Technique	Tissue	Remarks	Disease	ID_report	Reference	Remarks	Gender	Consanguinity	Country	Population	Age at death	VIP	Data_av	Treatment	Panel size	Owner
+/.	_1_23_	c.-234_*4887{0}	r.0?	p.0?	-	-	Unknown	ACMG	pathogenic (dominant)	g.135663893_135948645del	-	-	-	TSC1_001479	284753bp multigene deletion; entire TSC1 deleted (ex 1-23) + 128625bp upstream of TSC1 + 102844bp downstream of TSC1; upstream deletion involves entire GFI1B, GTF3C5, LOC100996574, CEL genes; downstream deletion involves entire SPACA9 and part of AK8	PubMed: Ogorek, 2020	-	-	Germline	?	-	-	-	-	DNA	MLPA, SEQ, SEQ-NG-I	Blood	Targeted massive parallel sequencing, mean target coverage of 327× to 1614× (median 716×), MLPA TSC1 P124-C1 probe mix used, Genome sequencing also done, deletion confirmed by PCR across breakpoints, gel electrophoresis and Sanger sequencing	TSC	02-008	PubMed: Ogorek, 2020	infant; no history of TSC in the family; patient did not have subclinical or clinical seizures during the study	M	?	-	-	-	-	-	-	1	Rosemary Ekong
+/+	_1_23_	c.-234_*4887{0}	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.135663893_135948645del	-	-	-	TSC1_001479	284753bp multigene deletion; entire TSC1 deleted (ex 1-23) + 128625bp upstream of TSC1 + 102844bp downstream of TSC1; upstream deletion involves entire GFI1B, GTF3C5, LOC100996574, CEL genes; downstream deletion involves entire SPACA9 and part of AK8	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/-	20i	c.2626-4T[17_21]	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135773001A[17-21]	-	-	-	TSC1_000175	five alleles of 17-21monomer T runs (18 Ts in reference sequence)	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/-	9i	c.914-58T[27_30]	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135787013A[27_30]	-	-	-	TSC1_000330	microsatellite with base T repeated between 27 to 30 times	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+?/+?	_1_1i	c.[-234-u2538_-234-u2503del(+)-234-u2506_-144+4564delins7]	r.0?	p.0?	-	-	Unknown	-	likely pathogenic (dominant)	g.?	-	-	-	TSC1_000486	36bp del upstream of ex1; another 7161bp del involves ex1 and flanking sequences, plus insertion of 7 unspecified nts. into this region (origin unknown); 45 nts. between the 2 deletions; promoter region reported as -157bp to -744bp completely deleted	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+?/+?	_1_1i	c.[-234-u5895_-144+825del;chr9:g.135822115_135822270inv]	r.0?	p.0?	-	-	Unknown	-	likely pathogenic (dominant)	g.?	-	-	-	TSC1_000485	6811bp deletion; variant includes exon 1, upstream region, and a 156bp inverted sequence upstream of exon 1; promoter region reported between nts. -157bp and -744bp completely deleted	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+?/+?	_1_1i	c.[-234-u9132_-144+317del(+)-234-u9141_-234-u9086inv]	r.0?	p.0?	-	-	Unknown	-	likely pathogenic (dominant)	g.?	-	-	-	TSC1_000484	9540bp deletion; variant includes exon 1, upstream region, and a 56bp inverted sequence upstream of exon 1; promoter region reported between nts. -157bp and -744bp completely deleted	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	_1_23_	c.-23076_*17484del	r.?	p.?	-	-	Unknown	-	pathogenic (dominant)	g.135754139_135842863del	g.132878752_132967476del	c.-38403_*17484del88525	-	TSC1_000491	88525bp deletion involving the entire TSC1 gene and extending into the3'UTR; no inserted or inverted nucleotides found in the TSC1 region; deletion found with TSC2 missense c.2963G>C	PubMed: Sancak 2005; PubMed: van den Ouweland, 2011; PubMed: Hoogeveen-Westerveld 2011	-	-	De novo	-	1/3 individuals tested have the variant	-	-	-	DNA	MLPA, PCRq, PCRlr, SEQ	Blood	-	TSC	-	PubMed: Sancak 2005; PubMed: van den Ouweland, 2011; PubMed: Hoogeveen-Westerveld 2011	sporadic case; diagnosed with definite TSC at 30yrs; patient has TSC2 missense c.2963G>C and entire deletion of TSC1; the TSC1 deletion is absent in both unaffected parents; patient has inherited TSC2 c.2963G>C from one of the parents	F	-	-	-	-	-	-	-	1	Rosemary Ekong
+/+	_1_23_	c.-23076_*17484del	r.?	p.?	-	-	Unknown	-	pathogenic (dominant)	g.135754139_135842863del	g.132878752_132967476del	-	-	TSC1_000491	88525bp deletion involving the entire TSC1 gene and extending into the3'UTR	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	_1	c.-1055G>T	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135820841C>A	g.132945454C>A	-234-u841G>T (-1055G>T) [g.2597781G>T, NT_035014.4]	-	TSC1_000630	reported as poly; nt. numbering for described variant in the context of TSC1 continues from TSC1 5’UTR; found with TSC2 exons 2-22 del and TSC2 missense c.5359G>A; variant upstream of TSC1 5’UTR & in upstream NTHL1 gene (as NM_002528.5:c.139+669C>A)	unpublished	-	-	Unknown	-	1/3 individuals tested have the variant	NdeI+	-	-	DNA	SEQ	Blood	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-?/-?	_1	c.-1055G>T	r.(?)	p.(=)	-	-	Unknown	-	likely benign	g.135820841C>A	g.132945454C>A	-	-	TSC1_000630	nt. numbering in the context of TSC1 continues from TSC1 5’UTR (HGVS nomenclature = NG_012386.1:g.4180G>T); variant upstream of TSC1 5’UTR and is within the upstream NTHL1 gene (as NM_002528.5:c.139+669C>A)	-	-	rs1484881165	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	_1	c.-1001_-1000delinsAA	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135820786_135820787delinsTT	g.132945399_132945400delinsTT	-234-u787_u786 GC>AA (-1001_1000 GC>AA)	-	TSC1_000535	2bp deletion of GC and 2bp insertion of AA; reported as a common variant in 5' upstream region; composed of SNP rs77086994 = G>A and SNP rs11243938 = C>A	unpublished	-	-	Unknown	-	26/400 individuals tested have the variant	-	-	-	DNA	SEQ	Blood	-	TSC	-	unpublished	found in several patients; mutation-negative patients were used as controls for testing of this variant	?	-	-	-	-	-	-	-	26	Rosemary Ekong
-/-	_1	c.-1001_-1000delinsAA	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135820786_135820787delinsTT	g.132945399_132945400delinsTT	-	-	TSC1_000535	2bp deletion of GC and 2bp insertion of AA; common variant in 5' upstream region; HGVS nomenclature = NG_012386.1:g.4234_4235delinsAA	-	-	rs386739091	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	_1	c.-945T>G	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135820731A>C	g.132945344A>C	-234-u731 T>G (-945 T>G)	-	TSC1_000534	common variant in 5' upstream region	unpublished	-	rs4962225	Unknown	-	12/400 individuals tested have the variant	MnlI+	-	-	DNA	SEQ	Blood	-	TSC	-	unpublished	found in several patients; mutation-negative patients were used as controls for testing of this variant	?	-	-	-	-	-	-	-	12	Rosemary Ekong
-/-	_1	c.-945T>G	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135820731A>C	g.132945344A>C	-	-	TSC1_000534	common variant in 5' upstream region; HGVS nomenclature = NG_012386.1:g.4290T>G	-	-	rs4962225	SUMMARY record	-	-	MnlI+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	_1	c.-822G>A	r.(=)	p.(=)	-	-	Unknown	-	benign	g.135820608C>T	g.132945221C>T	-234-u608 G>A (-822 G>A)	-	TSC1_000533	common variant in 5' upstream region	unpublished	-	rs4962083	Unknown	-	22/400 individuals tested have the variant	MnlI-	-	-	DNA	SEQ	Blood	-	TSC	-	unpublished	found in several patients; mutation-negative patients were used as controls for testing of this variant	?	-	-	-	-	-	-	-	22	Rosemary Ekong
-/-	_1	c.-822G>A	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135820608C>T	g.132945221C>T	-	-	TSC1_000533	common variant in 5' upstream region; HGVS nomenclature = NG_012386.1:g.4413G>A	-	-	rs4962083	SUMMARY record	-	-	MnlI-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	_1_1i	c.-589_-144+307del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.135819624_135820376del	g.132944237_132944989del	c.-16116_-15364del753	-	TSC1_000487	753bp deletion involving exon 1 and flanking sequences; partial deletion of promoter region, reported between nts. -157bp and -744bp, leaving most 5' 155nts of basal transcription core still present; expression of this deletion not analysed	PubMed: van den Ouweland, 2011; PubMed: Ali, 2003	-	-	Germline	-	2/2 individuals tested have the variant	DdeI-, SmaI-	-	-	DNA	MLPA, PCRq, PCRlr	Blood	-	TSC	-	PubMed: van den Ouweland, 2011; PubMed: Ali, 2003	diagnosed as definite TSC at 19yrs; variant present in affected sib who has 2 major TS features	F	-	-	-	-	-	-	-	2	Rosemary Ekong
+?/+?	_1_1i	c.-589_-144+307del	r.0?	p.0?	-	-	Unknown	-	likely pathogenic (dominant)	g.135819624_135820376del	g.132944237_132944989del	-	-	TSC1_000487	753bp deletion involving exon 1 and flanking sequences; partial deletion of promoter region, reported between nts. -157bp and -744bp, leaving most 5' 155nts of basal transcription core still present; expression of this deletion not analysed	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	_1	c.-438T>G	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135820224A>C	g.132944837A>C	-234-u204 T>G (-438 T>G)	-	TSC1_000527	reported as polymorphism; variant is upstream of TSC1 and not in 5’UTR or within any known transcript; found with TSC2 exon 42 deletion and PKD1 ex 40 & 46 del; HGVS compliant description = NG_012386.1:g.4797T>G (TSC1) or NC_000009.11:g.135820224A>C	unpublished	-	-	Unknown	-	-	HpyAV-	-	-	DNA	SEQ	Blood	-	TSC	-	unpublished	proband has a variant upstream of TSC1 5'UTR and a TSC2 ex42 deletion that extends into PKD1 ex46; parents not tested; mutation-negative patients used as control for testing the variant upstream of TSC1 5'UTR and variant only seen in this family	?	-	-	-	-	-	-	-	1	Rosemary Ekong
-?/-?	_1	c.-438T>G	r.(?)	p.(=)	-	-	Unknown	-	likely benign	g.135820224A>C	g.132944837A>C	-	-	TSC1_000527	variant is upstream of TSC1; HGVS compliant description = NG_012386.1:g.4797T>G (TSC1)	-	-	rs1041499541	SUMMARY record	-	-	HpyAV-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	_1_1i	c.-295_-144+105del{0}	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.135819825_135820081del	g.132944438_132944694del	deletion exon 1, genomic deletion: 135819825 to 135820081	-	TSC1_001437	exon 1 deleted; reported that NGS analysis after g.135820081 was not done; partial deletion of promoter region (reported between nts. -157bp and -744bp); deletion found with TSC2 c.4149C>T (confirmed splice variant in a different case)	unpublished	-	-	Germline	-	1/2 individuals tested has the variant	-	-	-	DNA	DHPLC, MLPA, SEQ, SEQ-NG	Blood	TSC1 deletion detected by MLPA and verified by NGS. TSC2 variant detected by DHPLC, Sanger SEQ and NGS.	TSC	-	unpublished	patient reported to have TSC1 exon 1 deletion and TSC2 silent variant c.4149C>T; the one parent tested has TSC1 c.4149C>T but not the TSC1 exon 1 deletion	F	-	-	-	-	-	-	-	1	Rosemary Ekong
?/?	_1_1i	c.-295_-144+105del{0}	r.0?	p.0?	-	-	Unknown	-	VUS	g.135819825_135820081del	g.132944438_132944694del	-	-	TSC1_001437	exon 1 deleted; the deletion partially removes the promoter region which is reported between nts. -157bp and -744bp; effect on TSC1 expression unknown	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	_1	c.-278dup	r.(?)	p.(=)	-	-	Maternal (confirmed)	-	benign	g.135820068dup	g.132944681dup	-	-	TSC1_000532	1bp duplication of G upstream of exon 1; reported as polymorphism; HGVS nomenclature = NG_012386.1:g.4957dupG (TSC1) or NG_034227.1:g.4137dupC (GFI1B)	unpublished	-	-	Germline	-	2/3 individuals tested have the variant	BslI+	-	-	DNA	SEQ	Blood	-	TSC	-	unpublished	not-TSC proband and does not have a disease-causing variant; variant also seen in one of the healthy parents; mutation-negative patients were used as controls for testing of this variant and variant seen in another family	?	-	-	-	-	-	-	-	2	Rosemary Ekong
-/.	_1	c.-278dup	r.(?)	p.(=)	-	-	Paternal (confirmed)	-	benign	g.135820068dup	g.132944681dup	-	-	TSC1_000532	1bp duplication of G upstream of exon 1; reported as polymorphism; found with TSC1 exon 1 deletion; HGVS = NG_012386.1:g.4957dupG (TSC1) or NG_034227.1:g.4137dupC (GFI1B)	unpublished	-	-	Germline	-	2/3 individuals tested have the variant	BslI+	-	-	DNA	MLPA, SEQ	Blood	-	TSC	-	unpublished	proband has both TSC1 variant 5' upstream and de novo TSC1 exon 1 deletion; TSC1 variant 5' upstream also seen in one healthy parent; mutation-negative patients were used as controls for testing TSC1 variant 5' upstream and variant seen in another family	?	-	-	-	-	-	-	-	1	Rosemary Ekong
-/-	_1	c.-278dup	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135820068dup	g.132944681dup	-	-	TSC1_000532	1bp duplication of G upstream of exon 1; HGVS nomenclature = NG_012386.1:g.4957dup (TSC1) or NG_034227.1:g.4137dupC (GFI1B)	-	-	rs544305928	SUMMARY record	-	-	BslI+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	_1_1i	c.(?_-234)_(-144+1_-143-1)del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(135810483_135819929)_(135820020_?)del	-	deletion in exon 1	-	TSC1_000512	exon 1 deletion seen with TSC1 MLPA P124-B1 kit; breakpoints not determined	PubMed: Jang, 2012	-	-	Unknown	-	-	-	-	-	DNA	MLPA	Blood	-	TSC	-	PubMed: Jang, 2012	25yr old with seizures from 5yrs old; patient has subependymal nodules & multifocal subcortical white matter changes; signs of obsessive-compulsive disorder; family history of facial angiofibromas and seizures in father and uncles; relatives not tested	M	-	Korea, South (Republic)	Seoul	-	-	-	-	1	Rosemary Ekong
+/.	_1_1i	c.(?_-234)_(-144+1_-143-1)del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(135810483_135819929)_(135820020_?)del	-	-	-	TSC1_000512	TSC1 exon 1 and at least 23kb upstream deleted; deletion removes the promoter region reported between nts. -157bp and -744bp	unpublished	-	-	De novo	-	1/3 individuals tested have the variant	-	-	-	DNA	MLPA, SEQ	Blood	-	TSC	-	unpublished	proband and one of the parents have the TSC1 missense variant c.3353A>G; proband has a de novo TSC1 5' deletion not seen in parents	?	-	-	-	-	-	-	-	1	Rosemary Ekong
+/.	_1_1i	c.(?_-234)_(-144+1_-143-1)del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(135810483_135819929)_(135820020_?)del	-	c.-234_-144del, exon 1 deleted	-	TSC1_000512	exon 1 deleted; breakpoints undetermined; found with variant upstream of TSC1	unpublished	-	-	De novo	-	1/3 individuals tested have the variant	-	-	-	DNA	MLPA, SEQ	Blood	-	TSC	-	unpublished	proband has both TSC1 variant 5' upstream and de novo TSC1 exon 1 deletion; TSC1 variant 5' upstream also seen in one healthy parent; mutation-negative patients were used as controls for testing TSC1 variant 5' upstream and variant seen in another family	?	-	-	-	-	-	-	-	1	Rosemary Ekong
?/.	_1_1i	c.(?_-234)_(-144+1_-143-1)del	r.0?	p.0?	-	-	Unknown	-	VUS	g.(135810483_135819929)_(135820020_?)del	-	exon 1 del	-	TSC1_000512	exon 1 deleted; deletion breakpoints unknown; no other potentially pathogenic changes (large or small) seen; the deleted exon 1 MLPA probe is within the promoter region reported between nts. -157bp and -744bp; consequence on gene expression uncertain	unpublished	-	-	Unknown	-	-	-	-	-	DNA	MLPA, SEQ	Blood	-	TSC	-	unpublished	TS affected; no clinical features indicated; variant reported as of unknown clinical significance	F	-	-	-	-	-	-	-	1	Rosemary Ekong
+/.	_1_1i	c.(?_-234)_(-144+1_-143-1)del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(135810483_135819929)_(135820020_?)del	-	deletion exon 1	-	TSC1_000512	exon 1 deleted; deletion breakpoints undetermined	unpublished	-	-	Unknown	-	-	-	-	-	DNA	MLPA	Blood	-	TSC	-	unpublished	No other family member tested	F	-	-	-	-	-	-	-	1	Rosemary Ekong
+/.	_1_1i	c.(?_-234)_(-144+1_-143-1)del	r.0?	p.0?	-	-	Maternal (confirmed)	-	pathogenic (dominant)	g.(135810483_135819929)_(135820020_?)del	-	deletion exon 1	-	TSC1_000512	exon 1 deleted; deletion breakpoints undetermined	unpublished	-	-	Germline	-	6/8 individuals tested have the variant	-	-	-	DNA	MLPA	Blood	-	TSC	-	unpublished	affected parent, 2 affected siblings and 2 other ?affected siblings have the same variant; an unaffected sibling and affected parent's half sibling tested negative	F	-	-	-	-	-	-	-	6	Rosemary Ekong
+/.	_1_1i	c.(?_-234)_(-144+1_-143-1)del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(135810483_135819929)_(135820020_?)del	-	deletion exon 1	-	TSC1_000512	exon 1 deleted; deletion breakpoints undetermined	unpublished	-	-	De novo	-	1/4 individuals tested have the variant	-	-	-	DNA	MLPA	Blood	-	TSC	-	unpublished	variant is absent in both parents; an affected distant relative has a different variant (not specified) described as originating from the other side of the family	M	-	-	-	-	-	-	-	1	Rosemary Ekong
+/.	_1_1i	c.(?_-234)_(-144+1_-143-1)del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(135810483_135819929)_(135820020_?)del	-	deletion exon 1	-	TSC1_000512	exon 1 deleted; deletion breakpoints undetermined	unpublished	-	-	Unknown	-	-	-	-	-	DNA	MLPA	Blood	-	TSC	-	unpublished	No other family member tested	F	-	-	-	-	-	-	-	1	Rosemary Ekong
?/?	_1_1i	c.(?_-234)_(-144+1_-143-1)del	r.0?	p.0?	-	-	Unknown	-	VUS	g.(135810483_135819929)_(135820020_?)del	-	-	-	TSC1_000512	MLPA probe for exon 1 (GAGGGACTGTGA-GGTAAACAGCTG) is at c.-185_-162; promoter region reported between nts. -157bp and -744bp starts in exon 1 and is probably partially deleted, at least. Extent of the deletion and effect on gene expression not determined.	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	_1_1i	c.(?_-234)_(-144+1_-143-1)del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(135810483_135819929)_(135820020_?)del	-	-	-	TSC1_000512	TSC1 exon 1 and at least 23kb upstream deleted; deletion removes the promoter region reported between nts. -157bp and -744bp	-	-	-	Germline	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	_1_1i	c.(?_-234)_(-144+1_-143-1)del	r.?	p.?	-	-	Unknown	-	pathogenic (dominant)	g.(135810483_135819929)_(135820020_?)del	-	exon 1 del	-	TSC1_000512	deletion involves exon 1 and is predicted to extend into promoter region	unpublished	-	-	Germline	?	-	-	-	-	DNA	MLPA	Blood	-	TSC	-	unpublished	TS affected and has 2 affected children; no indication if tested; parents not tested	F	?	-	-	-	-	-	-	1	Rosemary Ekong
+/.	_1_1i	c.(?_-234)_(-144+1_-143-1)dup	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(135810483_135819929)_(135820020_?)dup	-	TSC1-E1 amplified	-	TSC1_000713	TSC1 exon 1 duplicated and breakpoints undetermined; partial dup of promoter region, reported between nts. -157bp and -744bp; TSC2 LOH seen; Oncomap negative	PubMed: Qin, 2011	-	-	Unknown	-	-	-	-	-	DNA	MLPA, SEQ	Kidney	-	?	-	PubMed: Qin, 2011	44yr old patient; no clinical features of TSC and no other known genetic disease other than features of renal AML	M	-	-	-	-	-	-	-	1	Rosemary Ekong
?/?	_1_1i	c.(?_-234)_(-144+1_-143-1)dup	r.0?	p.0?	-	-	Unknown	-	VUS	g.(135810483_135819929)_(135820020_?)dup	-	-	-	TSC1_000713	TSC1 exon 1 duplicated and breakpoints undetermined; partial duplication of promoter region, reported between nts. -157bp and -744bp (i.e. -157_-u510)	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	_1_8i	c.(?_-234)_(737+1_738-1)del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(135787845_135796749)_(135820020_?)del	-	deletion exon 1 to 8	-	TSC1_000908	exons 1-8 deleted; found with TSC1 intronic variant c.913+8G>C	unpublished	-	-	Unknown	-	1/2 individuals tested have the variant	-	-	-	DNA	DHPLC, MLPA, SEQ	Blood	-	TSC	-	unpublished	patient has TSC1 exons 1-8 deletion (c.-234_737+?del) and TSC1 intronic variant c.913+8G>C; TSC1 exons 1-8 deletion is absent in the one parent tested; inheritance of TSC1 c.913+8G>C not indicated	M	-	-	-	-	-	-	-	1	Rosemary Ekong
+/+	_1_8i	c.(?_-234)_(737+1_738-1)del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(135787845_135796749)_(135820020_?)del	-	-	-	TSC1_000908	exons 1-8 deleted	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	1i_14i	c.(?_-234)_(1438+1_1439-1)del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(135781527_135782117)_(135820020_?)del	-	-	-	TSC1_000801	exons 1-14 deleted	PubMed: Kwiatkowski, 2015	-	-	Unknown	-	-	-	-	-	DNA	SEQ	Blood	-	TSC	-	PubMed: Kwiatkowski, 2015	patient has TSC with AML	?	-	-	-	-	-	-	-	1	Rosemary Ekong
+/+	_1_14i	c.(?_-234)_(1438+1_1439-1)del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(135781527_135782117)_(135820020_?)del	-	-	-	TSC1_000801	exons 1-14 deleted	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	_1_23_	c.(?_-234)_(*4887_?)del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(?_135766735)_(135820020_?)del	-	deletion exon 1 to 23	-	TSC1_000170	exons 1-23 deleted	unpublished	-	-	Unknown	-	-	-	-	-	DNA	MLPA	Blood	-	TSC	-	unpublished	No other family member tested	F	-	-	-	-	-	-	-	1	Rosemary Ekong
+/.	_1_23_	c.(?_-234)_(*4887_?)del	r.0?	p.0?	-	-	Maternal (confirmed)	-	pathogenic (dominant)	g.(?_135766735)_(135820020_?)del	-	deletion exon 1 to 23	-	TSC1_000170	exons 1-23 deleted; found with TSC2 missense c.1378G>A	unpublished	-	-	Germline	-	2/8 individuals tested have the variant	-	-	-	DNA	DHPLC, MLPA, SEQ	Blood	-	TSC	-	unpublished	proband has TSC1 exon 1-23 deletion and TSC2 missense c.1378G>A; the affected parent has both variants; the unnaffected parent and 5 siblings of the affected parent are negative	F	-	-	-	-	-	-	-	2	Rosemary Ekong
+/.	_1_23_	c.(?_-234)_(*4887_?)del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(?_135766735)_(135820020_?)del	-	c.-234-?_*1+?del, del ex.1_ex.23	-	TSC1_000170	large deletion; exons 1-23 deleted; variant detected at 50% freq; NGS read depth >500x	PubMed: Tyburczy, 2015	-	-	De novo	-	1/3 individuals tested have the variant	-	-	-	DNA	MLPA	Blood	-	TSC	-	PubMed: Tyburczy, 2015	26 year old TSC patient with NMI status (previous Sanger SEQ and TSC2 MLPA negative); sporadic case with no FH of TS; both parents tested and variant not found	F	-	-	-	-	-	-	-	1	Rosemary Ekong
+/+	_1_23_	c.(?_-234)_(*4887_?)del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.(?_135766735)_(135820020_?)del	-	-	-	TSC1_000170	exons 1-23 deleted	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	_1	c.(?_-234)_?del(147000)	r.0?	p.0?	-	-	Maternal (confirmed)	-	pathogenic (dominant)	g.(?_135766735)_?del(147000)	g.(?_132891348)_?del(147000)	partial deletion TSC1	-	TSC1_001345	reported as 147kb deletion involving part of TSC1, GF11B and GTF3C5; extent of deletion into TSC1 not provided	PubMed: Gilboa 2018	-	-	Germline	yes	4/4 individuals tested have the variant	-	-	-	DNA	arrayCNV	Blood	CytoScan 750K array used	TSC	-	PubMed: Gilboa 2018	4 affected family members - index, 2 brothers and mother - all have the variant; none met the clinical diagnostic criteria; index had intractable seizures from birth but seizure free after resection; no other TSC features in index	F	?	Israel	-	-	-	-	-	4	Rosemary Ekong
?/?	_1	c.(?_-234)_?del(147000)	r.0?	p.0?	-	-	Unknown	-	VUS	g.(?_135766735)_?del(147000)	g.(?_132891348)_?del(147000)	-	-	TSC1_001345	147kb deletion involving part of TSC1, GF11B and GTF3C5 (both genes at 5’ of TSC1); deletedTSC1 exons not mentioned and extent of deletion into TSC1 undetermined	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-?/.	-	c.-227G>A	r.(?)	p.(=)	-	-	Unknown	-	likely benign	g.135820013C>T	g.132944626C>T	TSC1(NM_000368.5):c.-227G>A	-	TSC1_001233	VKGL data sharing initiative Nederland	-	-	-	CLASSIFICATION record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
?/?	1	c.-227G>A	r.(?)	p.?	-	unlikely to affect splicing	Unknown	-	VUS	g.135820013C>T	g.132944626C>T	-	-	TSC1_001233	-	-	-	rs886063629	SUMMARY record	-	-	BseRI+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	1_1i	c.-219_-144+3del	r.0?	p.0?	-	-	Unknown	-	pathogenic (dominant)	g.135819931_135820009del	g.132944544_132944622del	exon 1 del, genomic coordinates = 135,819,930-135,820,008	-	TSC1_001471	exon 1 deleted; confirmed by qPCR. qPCR result consistent with MLPA	unpublished	-	-	Germline	?	-	-	-	-	DNA	MLPA, PCRq	Blood	-	TSC	-	unpublished	parent with epilepsy not tested	?	?	-	-	-	-	-	-	1	Rosemary Ekong
?/?	1_1i	c.-219_-144+3del	r.0?	p.0?	-	-	Unknown	-	VUS	g.135819931_135820009del	g.132944544_132944622del	-	-	TSC1_001471	79bp deletion extends from exon 1 to intron 1; deletion extends into the promoter region which starts in exon 1 and is reported to be between nts. -157bp and -744bp; promoter region partially deleted. Effect on gene expression not determined.	-	-	-	SUMMARY record	-	-	AluI-, BanI-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
?/.	1	c.-159G>A	r.(?)	p.(=)	-	unlikely to affect splicing	Unknown	-	VUS	g.135819945C>T	g.132944558C>T	-	-	TSC1_001333	found with TSC2 missense c.3284G>T that affects last base of exon	unpublished	-	-	Germline	?	-	BbvCI-, Bpu10I-	-	-	DNA	SEQ-NG	Blood	-	TSC	-	unpublished	clinical features not specified; parents not tested	F	?	-	-	-	-	-	-	1	Rosemary Ekong
?/?	1	c.-159G>A	r.(?)	p.(=)	-	unlikely to affect splicing	Unknown	-	VUS	g.135819945C>T	g.132944558C>T	-	-	TSC1_001333	-	-	-	-	SUMMARY record	-	-	BbvCI-, Bpu10I-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-?/.	-	c.-144+7A>T	r.(=)	p.(=)	-	-	Unknown	-	likely benign	g.135819923T>A	g.132944536T>A	TSC1(NM_000368.5):c.-144+7A>T	-	TSC1_001315	VKGL data sharing initiative Nederland	-	-	-	CLASSIFICATION record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
?/?	1i	c.-144+7A>T	r.(?)	p.(=)	-	unlikely to affect splicing	Unknown	-	VUS	g.135819923T>A	g.132944536T>A	-	-	TSC1_001315	-	-	-	rs563924788	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-?/.	-	c.-144+8T>G	r.(=)	p.(=)	-	-	Unknown	-	likely benign	g.135819922A>C	-	TSC1(NM_000368.4):c.-144+8T>G (p.?)	-	TSC1_001636	VKGL data sharing initiative Nederland	-	-	-	CLASSIFICATION record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-?/-?	1i	c.-144+1475A>G	r.(?)	p.(=)	-	-	Unknown	-	likely benign	g.135818455T>C	g.132943068T>C	-	-	TSC1_000529	-	-	-	-	SUMMARY record	-	-	Hpy188III-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	1i	c.-144+1530T>G	r.(?)	p.(=)	-	-	Paternal (confirmed)	-	benign	g.135818400A>C	g.132943013A>C	I-01	-	TSC1_000530	-	unpublished	-	-	Germline	-	2/3 individuals tested have the variant	BsaJI+, BstNI+	-	-	DNA	SEQ	Blood	-	TSC	-	unpublished	seen in proband who does not have any other TSC1 or TSC2 variant; also seen in one healthy parent	?	-	-	-	-	-	-	-	2	Rosemary Ekong
-?/-?	1i	c.-144+1530T>G	r.(?)	p.(=)	-	-	Unknown	-	likely benign	g.135818400A>C	g.132943013A>C	-	-	TSC1_000530	-	-	-	rs989297207	SUMMARY record	-	1/31398 alleles	BsaJI+, BstNI+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	1i_23_	c.-144+3172_*67438del	r.?	p.?	-	-	Unknown	-	pathogenic (dominant)	g.135704184_135816758del	g.132828797_132941371del	c.-12499_*67438del112575	-	TSC1_000488	112575bp deletion starting in intron 1 and including exons 2-23 and 3'UTR; no inserted or inverted nucleotides found	PubMed: van den Ouweland, 2011	-	-	De novo	-	1/3 individuals tested have the variant	-	-	-	DNA	MLPA, PCRq, PCRlr	Blood	-	TSC	-	PubMed: van den Ouweland, 2011	sporadic case diagnosed with definite TSC at 7yrs; variant not seen in both unaffected parents	F	-	-	-	-	-	-	-	1	Rosemary Ekong
+/+	1i_23_	c.-144+3172_*67438del	r.?	p.?	-	-	Unknown	-	pathogenic (dominant)	g.135704184_135816758del	g.132828797_132941371del	-	-	TSC1_000488	112575bp deletion starting in intron 1 and including exons 2-23 and 3'UTR	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	_1_5i	c.(?_-143-1)_(363+1_364-1)del	r.?	p.?	-	-	Unknown	-	pathogenic (dominant)	g.(135798880_135800973)_(135810483_?)del	-	ex 1-5 del	-	TSC1_001466	exons 1-5 deleted; 5' end of deletion not determined	unpublished	-	-	Germline	yes	2/4 individuals tested have the variant	-	-	-	DNA	MLPA, SEQ-NG-I, SEQ	Blood	-	TSC	-	unpublished	patient with clinical diagnosis of TSC; clinically affected sibling has the variant; both parents tested and variant absent in parents; germline mosaicism not excluded	M	?	-	-	-	-	-	-	2	Rosemary Ekong
+/+	_1_5i	c.(?_-143-1)_(363+1_364-1)del	r.?	p.?	-	-	Unknown	-	pathogenic	g.(135798880_135800973)_(135810483_?)del	-	-	-	TSC1_001466	exons 1-5 deleted; 5' end of deletion not determined	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	1i_23_	c.(-144+1_-143-1)_(*4887_?)del	r.?	p.?	-	-	Unknown	-	pathogenic (dominant)	g.(?_135766735)_(135810483_135819929)del	-	exon 2-23 del	-	TSC1_000716	exons 2-23 deleted; consistently reduced level of amplification for exon 2-23; complete screen; MLPA kits P124 (TSC1), P046 (TSC2)	unpublished	-	-	Unknown	-	-	-	-	-	DNA	MLPA, SEQ	Blood	-	TSC	-	unpublished	no FH of TS; no clinical features reported; indicated as possible somatic mosaic; parents not tested; referred for diagnostic TS testing	F	-	-	-	-	-	-	-	1	Rosemary Ekong
+/.	1i_23_	c.(-144+1_-143-1)_(*4887_?)del	r.?	p.?	-	-	Maternal (confirmed)	-	pathogenic (dominant)	g.(?_135766735)_(135810483_135819929)del	-	exon 2-23 del	-	TSC1_000716	exons 2-23 deleted; no other potentially pathogenic variant found; complete screen; MLPA kits P124 (TSC1), P046 (TSC2) used	unpublished	-	-	Germline	-	2/4 individuals tested have the variant	-	-	-	DNA	MLPA, SEQ	Blood	-	TSC	-	unpublished	index with clinical TS; no clinical features mentioned for index or family members tested; variant arose de novo in a parent of the index as both grandparents of index do not have the variant	F	-	-	-	-	-	-	-	2	Rosemary Ekong
+/+	1i_23_	c.(-144+1_-143-1)_(*4887_?)del	r.?	p.?	-	-	Unknown	-	pathogenic (dominant)	g.(?_135766735)_(135810483_135819929)del	-	-	-	TSC1_000716	exons 2-23 deleted	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	1	c.-131del	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135810470del	g.132935083del	TSC1(NM_000368.4):c.-131delT	-	TSC1_001232	VKGL data sharing initiative Nederland	-	-	-	CLASSIFICATION record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-?/-?	2	c.-131del	r.(?)	p.?	-	unlikely to affect splicing	Unknown	-	likely benign	g.135810470del	g.132935083del	-	-	TSC1_001232	1bp deletion of A	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	-	c.-129A>T	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135810468T>A	g.132935081T>A	TSC1(NM_000368.5):c.-129A>T	-	TSC1_000239	VKGL data sharing initiative Nederland	-	-	-	CLASSIFICATION record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	2	c.-129A>T	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135810468T>A	g.132935081T>A	c.1-129A>T	-	TSC1_000239	-	PubMed: Au, 2007	-	-	Unknown	-	-	BpmI+, SexAI-	-	-	DNA	SEQ	Blood	-	TSC	-	PubMed: Au, 2007	-	?	-	-	-	-	-	-	-	1	Rosemary Ekong
-/.	2	c.-129A>T	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135810468T>A	g.132935081T>A	93A>T	-	TSC1_000239	original DNA description off by one; may also be c.-131A>T; variant found with TSC1 variants c.2392-35T>C and c.2425G>C (both in exon 19)	PubMed: Dabora, 1998	-	-	Unknown	-	-	BpmI+, SexAI-	-	-	DNA	DGGE	Blood	-	TSC	-	PubMed: Dabora, 1998	-	?	-	-	-	-	-	-	-	1	Rosemary Ekong
-/.	2	c.-129A>T	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135810468T>A	g.132935081T>A	-	-	TSC1_000239	variant in 5'UTR	-	-	rs116951280	Unknown	-	-	BpmI+, SexAI-	-	-	DNA	SEQ	Blood	-	Healthy/Control	-	-	variant reported amongst 60 CEU HapMap individuals in 1000Genome phase 1 population	?	-	-	-	-	-	-	-	1	Rosemary Ekong
-/.	2	c.-129A>T	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135810468T>A	g.132935081T>A	-	-	TSC1_000239	reported as polymorphism; found with TSC1 missense c.269T>G; variant seen in 10 other families but no other variants reported in these families; a total of 14 heterozygotes seen withthis variant	unpublished	-	-	Unknown	-	1/5 individuals tested have the variant	BpmI+, SexAI-	-	-	DNA	DHPLC, SEQ	Blood	-	TSC	P53/P54/P55	PubMed: Peron 2018	5 affecteds in 3 generations tested for TSC1 c.269T>G and all 5 patients (including one clinically affected parent and a sibling) have the variant; proband also has TSC1 5'UTR variant c.-129A>T; healthy family members were not tested for any of the TSC1 variants; TSC1 c.-129A>T tested in other patients where no other variant has been reported and TSC1 c.-129A>T seen 14 patients from 10 other families - no healthy relatives in these 10 families were tested for TSC1 c.-129A>T (Migone, personal communication)	M	?	Italy	-	-	-	-	-	5	Rosemary Ekong
-/-	2	c.-129A>T	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135810468T>A	g.132935081T>A	-	-	TSC1_000239	-	-	-	rs116951280	SUMMARY record	-	419/43980 alleles, 1 homozygotes	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	-	c.-99C>T	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135810438G>A	-	TSC1(NM_000368.5):c.-99C>T	-	TSC1_001566	VKGL data sharing initiative Nederland	-	-	-	CLASSIFICATION record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-?/.	-	c.-99C>T	r.(?)	p.(=)	-	-	Unknown	-	likely benign	g.135810438G>A	-	TSC1(NM_000368.5):c.-99C>T	-	TSC1_001566	VKGL data sharing initiative Nederland	-	-	-	CLASSIFICATION record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	2i	c.-80-396A>G	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135804735T>C	g.132929348T>C	I-02	-	TSC1_000537	common variant in intron 2	unpublished	-	rs3761840	Unknown	-	152/400 individuals tested have the variant	-	-	-	DNA	SEQ	Blood	-	TSC	-	unpublished	reported hets = 0.38 among patients; mutation-negative patients were used as controls for testing of this variant	?	-	-	-	-	-	-	-	152	Rosemary Ekong
-/-	2i	c.-80-396A>G	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135804735T>C	g.132929348T>C	-	-	TSC1_000537	common variant in intron 2	-	-	rs3761840	SUMMARY record	-	18687/43822 alleles, 2858 homozygotes	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/-	2i	c.-80-55T>C	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135804394A>G	g.132929007A>G	-	-	TSC1_000942	variant in intron 2	-	-	rs547649950	SUMMARY record	-	4/36404 alleles	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	2i	c.-80-55T>C	r.(?)	p.(=)	-	-	Paternal (confirmed)	-	benign	g.135804394A>G	g.132929007A>G	chr9 g.135804394A>G; c.80-55T>C; intron 3	-	TSC1_000942	variant in intron 2; validated by Sanger SEQ	PubMed: Nellist, 2015	-	rs547649950	Germline	-	2/3 individuals tested have the variant	-	-	-	DNA, RNA	SEQ-NG-I, SEQ	Blood, Skin fibroblast	-	TSC	I	PubMed: Nellist, 2015	13 yr old NMI patient; diagnosed at 0 yr; both parents clinically examined and no signs of TSC found; all variants inherited from mother except TSC1 variant reported as c.80-55T>C which is inherited from the father	?	-	-	-	-	-	-	-	2	Rosemary Ekong
-/.	2i	c.-80-51del	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135804396del	g.132929009del	c.-131delT, intron 2	-	TSC1_000608	1bp deletion of T; deleted base is in bracket and CAPITAL - cttgcaggtattttctttttt(T)atggagaaaaatggggccatttag	PubMed: Sancak, 2005	-	-	Unknown	-	-	-	-	-	DNA	SEQ	Blood	-	TSC	-	PubMed: Sancak, 2005	-	?	-	-	-	-	-	-	-	1	Rosemary Ekong
?/?	2i	c.-80-51del	r.(?)	p.(=)	-	-	Unknown	-	VUS	g.135804396del	g.132929009del	-	-	TSC1_000608	5'UTR variant; 1bp deletion of T; deleted base is in bracket and CAPITAL - cttgcaggtattttctttttt(T)atggagaaaaatggggccatttag	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	2i_8i	c.(-81+1_-80-1)_(737+1_738-1)del	r.?	p.?	-	-	Unknown	-	pathogenic (dominant)	g.(135787845_135796749)_(135804340_135810419)del	-	exons 3-8 deleted	-	TSC1_000782	exons 3-8 deleted; reported as disease-associated mutation; entire TSC1 and TSC2 genes sequenced; TSC1/TSC2 MLPA done; TSC1 deletion detected	unpublished	-	-	De novo	-	1/3 individuals tested have the variant	-	-	-	DNA	MLPA, SEQ	Blood	-	TSC	-	unpublished	sporadic case; TS affected; both parents reported as unaffected and tested; variant absent in both parents	M	-	-	-	-	-	-	-	1	Rosemary Ekong
+?/+?	2i_8i	c.(-81+1_-80-1)_(737+1_738-1)del	r.?	p.?	-	-	Unknown	-	likely pathogenic (dominant)	g.(135787845_135796749)_(135804340_135810419)del	-	-	-	TSC1_000782	exons 3-8 deleted	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	2i_14i	c.(-81+1_-80-1)_(1438+1_1439-1)del	r.(?)	p.?	-	-	Unknown	-	pathogenic (dominant)	g.(135804340_135810419)_(135781527_135782117)del	g.(132928953_132935032)_(132906140_132906730)del	NG_012386.1 (NM_000368.4): c.-(81+1_-80-1)_(1438-1_1439+1)del, exon 1	-	TSC1_001346	exons 3-14 deleted	PubMed: Peron 2018	-	-	Germline	?	-	-	-	-	DNA	MLPA	Blood	-	TSC	P223	PubMed: Peron 2018	parents reported as unaffected and not tested	F	?	Italy	-	-	-	-	-	1	Rosemary Ekong
+/+	2i_14i	c.(-81+1_-80-1)_(1438+1_1439-1)del	r.(?)	p.?	-	-	Unknown	-	pathogenic (dominant)	g.(135804340_135810419)_(135781527_135782117)del	g.(132928953_132935032)_(132906140_132906730)del	-	-	TSC1_001346	exons 3-14 deleted	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
+/.	2i_23_	c.(-81+1_-80-1)_(*4887_?)del	r.?	p.?	-	-	Maternal (confirmed)	-	pathogenic (dominant)	g.(?_135766735)_(135804340_135810419)del	-	exons 3-23 deleted	-	TSC1_000718	TSC1 3-23 deleted; found with TSC2 variant c.4959C>T; complete screen; MLPA kits P124 (TSC1), P046 (TSC2) used	unpublished	-	-	Germline	-	3/3 individuals tested have the variant	-	-	-	DNA	MLPA, SEQ	Blood	-	TSC	-	unpublished	index has TSC1 exon 3-23 deletion and TSC2 c.4959C>T; TSC1 deletion also found in affected parent and one affected sibling tested; an apparently unaffected sibling (not fully examined) and a possibly affected sibling were not tested	M	-	-	-	-	-	-	-	3	Rosemary Ekong
+/+	2i_23_	c.(-81+1_-80-1)_(*4887_?)del	r.?	p.?	-	-	Unknown	-	pathogenic (dominant)	g.(?_135766735)_(135804340_135810419)del	-	-	-	TSC1_000718	TSC1 3-23 deleted	-	-	-	SUMMARY record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
?/?	3	c.-44G>A	r.(?)	p.(=)	-	-	Unknown	-	VUS	g.135804303C>T	g.132928916C>T	-	-	TSC1_000541	-	-	-	rs773447503	SUMMARY record	-	7/249052 alleles	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-?/.	3	c.-44G>A	r.(?)	p.(=)	-	-	Unknown	-	likely benign	g.135804303C>T	g.132928916C>T	-	-	TSC1_000541	reported as probable polymorphism	unpublished	-	rs773447503	Unknown	-	-	AlwNI-, LpnPI-	-	-	DNA	SEQ	Blood	-	TSC	-	unpublished	reported that proband with this variant does not have a definite pathogenic variant found; parents not tested for variant	?	-	-	-	-	-	-	-	1	Rosemary Ekong
-/-	3	c.-16G>A	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135804275C>T	g.132928888C>T	-	-	TSC1_000538	-	-	-	rs114970627	SUMMARY record	-	18/282996 alleles	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	3	c.-16G>A	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135804275C>T	g.132928888C>T	-	-	TSC1_000538	5'UTR variant reported as polymorphism; found with TSC2 splice variant c.5252_5259+19del	unpublished	-	rs114970627	Unknown	-	-	HaeII-, HhaI-	-	-	DNA, RNA	SEQ	Blood	-	TSC	-	unpublished	proband has TSC1 5'UTR variant c.-16G>A and TSC2 splice variant c.5252_5259+19del; parents not tested; intron 40 sequence inserted = CTCAGCGGGGTGTGCTGGCTGCCCAAGCTGTGGGGCGGGTGTGTGGGCAGAGCGGTTGCCACGCCTCCCAGACTTACTGCCCAAGCCGCCTCTGCCTTCAG; amino acids inserted = QRGVLAAQAVGRVCGQSGCHASQTYCPSRLCLQ	?	-	-	-	-	-	-	-	1	Rosemary Ekong
-?/.	-	c.-7C>T	r.(?)	p.(=)	-	-	Unknown	-	likely benign	g.135804266G>A	g.132928879G>A	TSC1(NM_000368.4):c.-7C>T, TSC1(NM_000368.5):c.-7C>T	-	TSC1_000240	VKGL data sharing initiative Nederland	-	-	-	CLASSIFICATION record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-?/.	-	c.-7C>T	r.(?)	p.(=)	-	-	Unknown	-	likely benign	g.135804266G>A	g.132928879G>A	TSC1(NM_000368.4):c.-7C>T, TSC1(NM_000368.5):c.-7C>T	-	TSC1_000240	VKGL data sharing initiative Nederland	-	-	-	CLASSIFICATION record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	-	c.-7C>T	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135804266G>A	g.132928879G>A	TSC1(NM_000368.4):c.-7C>T, TSC1(NM_000368.5):c.-7C>T	-	TSC1_000240	VKGL data sharing initiative Nederland	-	-	-	CLASSIFICATION record	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
-/.	3	c.-7C>T	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135804266G>A	g.132928879G>A	c.1-7C>T	-	TSC1_000240	-	PubMed: Au, 2007	-	-	Unknown	-	-	-	-	-	DNA	SEQ	Blood	-	TSC	-	PubMed: Au, 2007	-	?	-	-	-	-	-	-	-	1	Rosemary Ekong
-/.	3	c.-7C>T	r.(?)	p.(=)	-	-	Unknown	-	benign	g.135804266G>A	g.132928879G>A	215C>T	-	TSC1_000240	rare variant in 5'UTR; seen in 1 patient; sequencing of RT-PCR revealed both alleles expressed; no effect on splicing seen; not seen in 50 CEPH controls	PubMed: Niida, 1999	-	-	Unknown	-	1/162 individuals tested have the variant	-	-	-	RNA	RT-PCR, SSCA	Blood	-	TSC	-	PubMed: Niida, 1999	parents unavailable for testing	?	-	-	-	-	-	-	-	1	Rosemary Ekong
?/.	3	c.-7C>T	r.(?)	p.(=)	-	-	Unknown	-	VUS	g.135804266G>A	g.132928879G>A	c.1-7C>T	-	TSC1_000240	7th base in 5'UTR; found with TSC1 nonsense variant c.2698C>T; small and large changes screened; MLPA kits P124 (TSC1) & P046 (TSC2) used	unpublished	-	-	Unknown	-	1/2 individuals tested have the variant	-	-	-	DNA	MLPA, SEQ	Blood	-	TSC	-	unpublished	possible family history of TS, but not formally diagnosed; one parent available for testing has subtle TS features (not specified) and has the TSC1 nonsense variant c.2698C>T; this parent was not tested for TSC1 c.-7C>T	M	-	-	-	-	-	-	-	2	Rosemary Ekong

	Legend	How to query	« First	‹ Prev		1	2	3	4	5	6	7	8	9	10	11	...		Next ›	Last »

Assessment of functional consequences - Our conclusions on the functional consequences of variants are based on the type of variant, results of in vitro functional tests (doi: 10.1002/humu.21451; doi: 10.1002/humu.22202; doi: 10.1002/humu.23963), population frequencies, output from in silico splice site prediction algorithms, and any clinical/family data available to us. We also have output from protein prediction programs in this database for comparison purposes and they are not considered in our assessment of pathogenicity. PolyPhen Predictions - Note that these results are from PolyPhen-2 and only the HumDiv classification is shown.

Global Variome shared LOVD

TSC1 (tuberous sclerosis 1)