insulin-like growth factor 1 (somatomedin C) (IGF1) - coding DNA reference sequence

(used for variant description)

(last modified March 10, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_001111283.1 in the IGF1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000012.11, covering IGF1 transcript NM_001111283.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5039
                      ttttgtagataaatgtgaggattttctctaaatccctct       c.-181

 .         .         .         .         .         .                g.5099
 tctgtttgctaaatctcactgtcactgctaaattcagagcagatagagcctgcgcaatgg       c.-121

 .         .         .         .         .         .                g.5159
 aataaagtcctcaaaattgaaatgtgacattgctctcaacatctcccatctctctggatt       c.-61

 .         .         .         .         .         .                g.5219
 tctttttgcttcattattcctgctaaccaattcattttcagactttgtacttcagaagca       c.-1

          .         .         .         .         .         .       g.5279
 ATGGGAAAAATCAGCAGTCTTCCAACCCAATTATTTAAGTGCTGCTTTTGTGATTTCTTG       c.60
 M  G  K  I  S  S  L  P  T  Q  L  F  K  C  C  F  C  D  F  L         p.20

     | 02    .         .         .         .         .         .    g.9858
 AAG | GTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTACCTGGCGCTGTGCCTGCTC    c.120
 K   | V  K  M  H  T  M  S  S  S  H  L  F  Y  L  A  L  C  L  L      p.40

          .         .         .         .         .         .       g.9918
 ACCTTCACCAGCTCTGCCACGGCTGGACCGGAGACGCTCTGCGGGGCTGAGCTGGTGGAT       c.180
 T  F  T  S  S  A  T  A  G  P  E  T  L  C  G  A  E  L  V  D         p.60

          .         .         .         . | 03       .         .    g.65930
 GCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCA | ACAAGCCCACAGGGTATGGC    c.240
 A  L  Q  F  V  C  G  D  R  G  F  Y  F  N |   K  P  T  G  Y  G      p.80

          .         .         .         .         .         .       g.65990
 TCCAGCAGTCGGAGGGCGCCTCAGACAGGCATCGTGGATGAGTGCTGCTTCCGGAGCTGT       c.300
 S  S  S  R  R  A  P  Q  T  G  I  V  D  E  C  C  F  R  S  C         p.100

          .         .         .         .         .         .       g.66050
 GATCTAAGGAGGCTGGAGATGTATTGCGCACCCCTCAAGCCTGCCAAGTCAGCTCGCTCT       c.360
 D  L  R  R  L  E  M  Y  C  A  P  L  K  P  A  K  S  A  R  S         p.120

          .         .         .         .   | 04     .         .    g.67615
 GTCCGTGCCCAGCGCCACACCGACATGCCCAAGACCCAGAAG | TATCAGCCCCCATCTACC    c.420
 V  R  A  Q  R  H  T  D  M  P  K  T  Q  K   | Y  Q  P  P  S  T      p.140

          .         .         .  | 05      .         .              g.83063
 AACAAGAACACGAAGTCTCAGAGAAGGAAAG | GAAGTACATTTGAAGAACGCAAGTAG       c.477
 N  K  N  T  K  S  Q  R  R  K  G |   S  T  F  E  E  R  K  X         p.158

          .         .         .         .         .         .       g.83123
 agggagtgcaggaaacaagaactacaggatgtaggaagaccctcctgaggagtgaagagt       c.*60

          .         .         .         .         .         .       g.83183
 gacatgccaccgcaggatcctttgctctgcacgagttacctgttaaactttggaacacct       c.*120

          .         .         .         .         .         .       g.83243
 accaaaaaataagtttgataacatttaaaagatgggcgtttcccccaatgaaatacacaa       c.*180

          .         .         .         .         .         .       g.83303
 gtaaacattccaacattgtctttaggagtgatttgcaccttgcaaaaatggtcctggagt       c.*240

          .         .         .         .         .         .       g.83363
 tggtagattgctgttgatcttttatcaataatgttctatagaaaagaaaaaaaaaatata       c.*300

          .         .         .         .         .         .       g.83423
 tatatatatatatcttagtccctgcctctcaagagccacaaatgcatgggtgttgtatag       c.*360

          .         .         .         .         .         .       g.83483
 atccagttgcactaaattcctctctgaatcttggctgctggagccattcattcagcaacc       c.*420

          .         .         .         .         .         .       g.83543
 ttgtctaagtggtttatgaattgtttccttatttgcacttctttctacacaactcgggct       c.*480

          .         .         .         .         .         .       g.83603
 gtttgttttacagtgtctgataatcttgttagtctatacccaccacctcccttcataacc       c.*540

          .         .         .         .         .         .       g.83663
 tttatatttgccgaatttggcctcctcaaaagcagcagcaagtcgtcaagaagcacacca       c.*600

          .         .         .         .         .         .       g.83723
 attctaacccacaagattccatctgtggcatttgtaccaaatataagttggatgcatttt       c.*660

          .         .         .         .         .         .       g.83783
 attttagacacaaagctttatttttccacatcatgcttacaaaaaagaataatgcaaata       c.*720

          .         .         .         .         .         .       g.83843
 gttgcaactttgaggccaatcatttttaggcatatgttttaaacatagaaagtttcttca       c.*780

          .         .         .         .         .         .       g.83903
 actcaaaagagttccttcaaatgatgagttaatgtgcaacctaattagtaactttcctct       c.*840

          .         .         .         .         .         .       g.83963
 ttttattttttccatatagagcactatgtaaatttagcatatcaattatacaggatatat       c.*900

          .         .         .         .         .         .       g.84023
 caaacagtatgtaaaactctgttttttagtataatggtgctattttgtagtttgttatat       c.*960

          .         .         .         .         .         .       g.84083
 gaaagagtctggccaaaacggtaatacgtgaaagcaaaacaataggggaagcctggagcc       c.*1020

          .         .         .         .         .         .       g.84143
 aaagatgacacaaggggaagggtactgaaaacaccatccatttgggaaagaaggcaaagt       c.*1080

          .         .         .         .         .         .       g.84203
 ccccccagttatgccttccaagaggaacttcagacacaaaagtccactgatgcaaattgg       c.*1140

          .         .         .         .         .         .       g.84263
 actggcgagtccagagaggaaactgtggaatggaaaaagcagaaggctaggaattttagc       c.*1200

          .         .         .         .         .         .       g.84323
 agtcctggtttctttttctcatggaagaaatgaacatctgccagctgtgtcatggactca       c.*1260

          .         .         .         .         .         .       g.84383
 ccactgtgtgaccttgggcaagtcacttcacctctctgtgcctcagtttcctcatctgca       c.*1320

          .         .         .         .         .         .       g.84443
 aaatgggggcaatatgtcatctacctacctcaaaggggtggtataaggtttaaaaagata       c.*1380

          .         .         .         .         .         .       g.84503
 aagattcagattttttttaccctgggttgctgtaagggtgcaacatcagggcgcttgagt       c.*1440

          .         .         .         .         .         .       g.84563
 tgctgagatgcaaggaattctataaataacccattcatagcatagctagagattggtgaa       c.*1500

          .         .         .         .         .         .       g.84623
 ttgaatgctcctgacatctcagttcttgtcagtgaagctatccaaataactggccaacta       c.*1560

          .         .         .         .         .         .       g.84683
 gttgttaaaagctaacagctcaatctcttaaaacacttttcaaaatatgtgggaagcatt       c.*1620

          .         .         .         .         .         .       g.84743
 tgattttcaatttgattttgaattctgcatttggttttatgaatacaaagataagtgaaa       c.*1680

          .         .         .         .         .         .       g.84803
 agagagaaaggaaaagaaaaaggagaaaaacaaagagatttctaccagtgaaaggggaat       c.*1740

          .         .         .         .         .         .       g.84863
 taattactctttgttagcactcactgactcttctatgcagttactacatatctagtaaaa       c.*1800

          .         .         .         .         .         .       g.84923
 cctcgtttaatactataaataatattctattcattttgaaaaacacaatgattccttctt       c.*1860

          .         .         .         .         .         .       g.84983
 ttctaggcaatataaggaaagtgatccaaaatttgaaatattaaaataatatctaataaa       c.*1920

          .         .         .         .         .         .       g.85043
 aagtcacaaagttatcttctttaacaaactttactcttattcttagctgtatatacattt       c.*1980

          .         .         .         .         .         .       g.85103
 ttttaaaagtttgttaaaatatgcttgactagagtttccagttgaaaggcaaaaacttcc       c.*2040

          .         .         .         .         .         .       g.85163
 atcacaacaagaaatttcccatgcctgctcagaagggtagcccctagctctctgtgaatg       c.*2100

          .         .         .         .         .         .       g.85223
 tgttttatccattcaactgaaaattggtatcaagaaagtccactggttagtgtactagtc       c.*2160

          .         .         .         .         .         .       g.85283
 catcatagcctagaaaatgatccctatctgcagatcaagattttctcattagaacaatga       c.*2220

          .         .         .         .         .         .       g.85343
 attatccagcattcagatctttctagtcaccttagaactttttggttaaaagtacccagg       c.*2280

          .         .         .         .         .         .       g.85403
 cttgattatttcatgcaaattctatattttacattcttggaaagtctatatgaaaaacaa       c.*2340

          .         .         .         .         .         .       g.85463
 aaataacatcttcagtttttctcccactgggtcacctcaaggatcagaggccaggaaaaa       c.*2400

          .         .         .         .         .         .       g.85523
 aaaaaaaaagactccctggatctctgaatatatgcaaaaagaaggccccatttagtggag       c.*2460

          .         .         .         .         .         .       g.85583
 ccagcaatcctgttcagtcaacaagtattttaactctcagtccaacattatttgaattga       c.*2520

          .         .         .         .         .         .       g.85643
 gcacctcaagcatgcttagcaatgttctaatcactatggacagatgtaaaagaaactata       c.*2580

          .         .         .         .         .         .       g.85703
 catcatttttgccctctgcctgttttccagacatacaggttctgtggaataagatactgg       c.*2640

          .         .         .         .         .         .       g.85763
 actcctcttcccaagatggcacttctttttatttcttgtccccagtgtgtaccttttaaa       c.*2700

          .         .         .         .         .         .       g.85823
 attattccctctcaacaaaactttataggcagtcttctgcagacttaacgtgttttctgt       c.*2760

          .         .         .         .         .         .       g.85883
 catagttagatgtgataattctaagagtgtctatgacttatttccttcacttaattctat       c.*2820

          .         .         .         .         .         .       g.85943
 ccacagtcaaaaatcccccaaggaggaaagctgaaagatgcactgccatattatctttct       c.*2880

          .         .         .         .         .         .       g.86003
 taactttttccaacacataatcctctccaactggattataaataaattgaaaataactca       c.*2940

          .         .         .         .         .         .       g.86063
 ttataccaattcactattttattttttaatgaattaaaactagaaaacaaattgatgcaa       c.*3000

          .         .         .         .         .         .       g.86123
 accctggaagtcagttgattactatatactacagcagaatgactcagatttcatagaaag       c.*3060

          .         .         .         .         .         .       g.86183
 gagcaaccaaaatgtcacaacccaaaactttacaagctttgcttcagaattagattgctt       c.*3120

          .         .         .         .         .         .       g.86243
 tataattcttgaatgaggcaatttcaagatatttgtaaaagaacagtaaacattggtaag       c.*3180

          .         .         .         .         .         .       g.86303
 aatgagctttcaactcataggcttatttccaatttaattgaccatactggatacttaggt       c.*3240

          .         .         .         .         .         .       g.86363
 caaatttctgttctctcttccccaaataatattaaagtattatttgaactttttaagatg       c.*3300

          .         .         .         .         .         .       g.86423
 aggcagttcccctgaaaaagttaatgcagctctccatcagaatccactcttctagggata       c.*3360

          .         .         .         .         .         .       g.86483
 tgaaaatctcttaacacccaccctacatacacagacacacacacacacacacacacacac       c.*3420

          .         .         .         .         .         .       g.86543
 acacacacacacattcaccctaaggatccaatggaatactgaaaagaaatcacttccttg       c.*3480

          .         .         .         .         .         .       g.86603
 aaaattttattaaaaaacaaacaaacaaacaaaaagcctgtccacccttgagaatccttc       c.*3540

          .         .         .         .         .         .       g.86663
 ctctccttggaacgtcaatgtttgtgtagatgaaaccatctcatgctctgtggctccagg       c.*3600

          .         .         .         .         .         .       g.86723
 gtttctgttactattttatgcacttgggagaaggcttagaataaaagatgtagcacattt       c.*3660

          .         .         .         .         .         .       g.86783
 tgctttcccatttattgtttggccagctatgccaatgtggtgctattgtttctttaagaa       c.*3720

          .         .         .         .         .         .       g.86843
 agtacttgactaaaaaaaaaagaaaaaaagaaaaaaaagaaagcatagacatattttttt       c.*3780

          .         .         .         .         .         .       g.86903
 aaagtataaaaacaacaattctatagatagatggcttaataaaatagcattaggtctatc       c.*3840

          .         .         .         .         .         .       g.86963
 tagccaccaccacctttcaactttttatcactcacaagtagtgtactgttcaccaaattg       c.*3900

          .         .         .         .         .         .       g.87023
 tgaatttgggggtgcaggggcaggagttggaaattttttaaagttagaaggctccattgt       c.*3960

          .         .         .         .         .         .       g.87083
 tttgttggctctcaaacttagcaaaattagcaatatattatccaatcttctgaacttgat       c.*4020

          .         .         .         .         .         .       g.87143
 caagagcatggagaataaacgcgggaaaaaagatcttataggcaaatagaagaatttaaa       c.*4080

          .         .         .         .         .         .       g.87203
 agataagtaagttccttattgatttttgtgcactctgctctaaaacagatattcagcaag       c.*4140

          .         .         .         .         .         .       g.87263
 tggagaaaataagaacaaagagaaaaaatacatagatttacctgcaaaaaatagcttctg       c.*4200

          .         .         .         .         .         .       g.87323
 ccaaatcccccttgggtattctttggcatttactggtttatagaagacattctcccttca       c.*4260

          .         .         .         .         .         .       g.87383
 cccagacatctcaaagagcagtagctctcatgaaaagcaatcactgatctcatttgggaa       c.*4320

          .         .         .         .         .         .       g.87443
 atgttggaaagtatttccttatgagatgggggttatctactgataaagaaagaatttatg       c.*4380

          .         .         .         .         .         .       g.87503
 agaaattgttgaaagagatggctaacaatctgtgaagattttttgtttcttgtttttgtt       c.*4440

          .         .         .         .         .         .       g.87563
 ttttttttttttttactttatacagtctttatgaatttcttaatgttcaaaatgacttgg       c.*4500

          .         .         .         .         .         .       g.87623
 ttcttttcttctttttttatatcagaatgaggaataataagttaaacccacatagactct       c.*4560

          .         .         .         .         .         .       g.87683
 ttaaaactataggctagatagaaatgtatgtttgacttgttgaagctataatcagactat       c.*4620

          .         .         .         .         .         .       g.87743
 ttaaaatgttttgctatttttaatcttaaaagattgtgctaatttattagagcagaacct       c.*4680

          .         .         .         .         .         .       g.87803
 gtttggctctcctcagaagaaagaatctttccattcaaatcacatggctttccaccaata       c.*4740

          .         .         .         .         .         .       g.87863
 ttttcaaaagataaatctgatttatgcaatggcatcatttattttaaaacagaagaattg       c.*4800

          .         .         .         .         .         .       g.87923
 tgaaagtttatgcccctcccttgcaaagaccataaagtccagatctggtaggggggcaac       c.*4860

          .         .         .         .         .         .       g.87983
 aacaaaaggaaaatgttgttgattcttggttttggattttgttttgttttcaatgctagt       c.*4920

          .         .         .         .         .         .       g.88043
 gtttaatcctgtagtacatatttgcttattgctattttaatattttataagaccttcctg       c.*4980

          .         .         .         .         .         .       g.88103
 ttaggtattagaaagtgatacatagatatcttttttgtgtaatttctatttaaaaaagag       c.*5040

          .         .         .         .         .         .       g.88163
 agaagactgtcagaagctttaagtgcatatggtacaggataaagatatcaatttaaataa       c.*5100

          .         .         .         .         .         .       g.88223
 ccaattcctatctggaacaatgcttttgttttttaaagaaacctctcacagataagacag       c.*5160

          .         .         .         .         .         .       g.88283
 aggcccaggggatttttgaagctgtctttattctgcccccatcccaacccagcccttatt       c.*5220

          .         .         .         .         .         .       g.88343
 attttagtatctgcctcagaattttatagagggctgaccaagctgaaactctagaattaa       c.*5280

          .         .         .         .         .         .       g.88403
 aggaacctcactgaaaacatatatttcacgtgttccctctttttttttttcctttttgtg       c.*5340

          .         .         .         .         .         .       g.88463
 agatggggtctcgcactgtcccccaggctggagtgcagtggcatgatctcggctcactgc       c.*5400

          .         .         .         .         .         .       g.88523
 aacctccacctcctgggtttaagcgattctcctgcctcagcctcctgagtagctgggatt       c.*5460

          .         .         .         .         .         .       g.88583
 acaggcacccaccactatgcccggctaattttttggatttttaatagagacggggtttta       c.*5520

          .         .         .         .         .         .       g.88643
 ccatgttggccaggttggtctcaaactcctgaccttgtgatttgcccgcctcagcctccc       c.*5580

          .         .         .         .         .         .       g.88703
 aaattgctgggattacaggcatgagccaccacaccctgcccatgtgttccctcttaatgt       c.*5640

          .         .         .         .         .         .       g.88763
 atgattacatggatcttaaacatgatccttctctcctcattcttcaactatctttgatgg       c.*5700

          .         .         .         .         .         .       g.88823
 ggtctttcaaggggaaaaaaatccaagcttttttaaagtaaaaaaaaaaaaagagaggac       c.*5760

          .         .         .         .         .         .       g.88883
 acaaaaccaaatgttactgctcaactgaaatatgagttaagatggagacagagtttctcc       c.*5820

          .         .         .         .         .         .       g.88943
 taataaccggagctgaattacctttcactttcaaaaacatgaccttccacaatccttaga       c.*5880

          .         .         .         .         .         .       g.89003
 atctgcctttttttatattactgaggcctaaaagtaaacattactcattttattttgccc       c.*5940

          .         .         .         .         .         .       g.89063
 aaaatgcactgatgtaaagtaggaaaaataaaaacagagctctaaaatccctttcaagcc       c.*6000

          .         .         .         .         .         .       g.89123
 acccattgaccccactcaccaactcatagcaaagtcacttctgttaatcccttaatctga       c.*6060

          .         .         .         .         .         .       g.89183
 ttttgtttggatatttatcttgtacccgctgctaaacacactgcaggagggactctgaaa       c.*6120

          .         .         .         .         .         .       g.89243
 cctcaagctgtctacttacatcttttatctgtgtctgtgtatcatgaaaatgtctattca       c.*6180

          .         .         .         .         .         .       g.89303
 aaatatcaaaacctttcaaatatcacgcagcttatattcagtttacataaaggccccaaa       c.*6240

          .         .         .         .         .         .       g.89363
 taccatgtcagatctttttggtaaaagagttaatgaactatgagaattgggattacatca       c.*6300

          .         .         .         .         .         .       g.89423
 tgtattttgcctcatgtatttttatcacacttataggccaagtgtgataaataaacttac       c.*6360

          .         .         .         .         .         .       g.89483
 agacactgaattaatttcccctgctactttgaaaccagaaaataatgactggccattcgt       c.*6420

          .         .         .         .         .         .       g.89543
 tacatctgtcttagttgaaaagcatattttttattaaattaattctgattgtatttgaaa       c.*6480

          .         .         .         .         .         .       g.89603
 ttattattcaattcacttatggcagaggaatatcaatcctaatgacttctaaaaatgtaa       c.*6540

          .         .         .         .         .         .       g.89663
 ctaattgaatcattatcttacatttactgtttaataagcatattttgaaaatgtatggct       c.*6600

          .         .         .         .         .         .       g.89723
 agagtgtcataataaaatggtatatctttctttagtaattacattaaaattagtcatgtt       c.*6660

          .                                                         g.89737
 tgattaattagttc                                                     c.*6674

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Insulin-like growth factor 1 (somatomedin C) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 18
©2004-2017 Leiden University Medical Center