All transcript variants in gene ARSE

Information The variants shown are described using the NM_000047.2 transcript reference sequence.

167 entries on 2 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. _1_2i c.(?_-21)_23+?del r.(?) p.0? - pathogenic g.? - - - ARSE_000021 deletion exons 1-2 PubMed: Nino 2008 - - Germline - - - 0 - Claudia Matos-Miranda
+/. _1_2i c.(?_-21)_23+?del r.(?) p.0? - pathogenic g.? - - - ARSE_000021 deletion exons 1-2 PubMed: Nino 2008 - - Germline - - - 0 - Claudia Matos-Miranda
-/. - c.-10G>C r.(?) p.(=) - benign g.2878451C>G g.2960410C>G ARSE(NM_001282631.1):c.18G>C (p.E6D) - ARSE_000075 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 - pathogenic g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - Gene Dx
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 - pathogenic g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - Gene Dx
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 - pathogenic g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - Gene Dx
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 - pathogenic g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - Gene Dx
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 - pathogenic g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene PubMed: Brunetti-Pierri 2003 - - Germline - - - 0 - Claudia Matos-Miranda
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 - pathogenic g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene PubMed: Brunetti-Pierri 2003 - - Germline - - - 0 - Claudia Matos-Miranda
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 - pathogenic g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene PubMed: Nino 2008 - - Germline - - - 0 - Claudia Matos-Miranda
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 - pathogenic g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - Gene Dx
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 - pathogenic g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - Gene Dx
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 - pathogenic g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - Gene Dx
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 - pathogenic g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - Gene Dx
-?/. - c.23+5G>C r.spl? p.? - likely benign g.2878414C>G g.2960373C>G ARSE(NM_000047.2):c.23+5G>C (p.?), ARSE(NM_001282628.1):c.-189+5G>C - ARSE_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.23+5G>C r.spl? p.? - likely benign g.2878414C>G - ARSE(NM_000047.2):c.23+5G>C (p.?), ARSE(NM_001282628.1):c.-189+5G>C - ARSE_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.23+115G>A r.(=) p.(=) - VUS g.2878304C>T g.2960263C>T - - ARSE_000059 - - - - Germline - - - - - Yu Sun
?/. - c.23+115G>A r.(=) p.(=) - VUS g.2878304C>T g.2960263C>T - - ARSE_000059 - - - - Germline - - - - - Yu Sun
?/. - c.23+123A>G r.(=) p.(=) - VUS g.2878296T>C g.2960255T>C - - ARSE_000057 - - - - Germline - - - - - Yu Sun
?/. - c.23+123A>G r.(=) p.(=) - VUS g.2878296T>C g.2960255T>C - - ARSE_000057 - - - - Germline - - - - - Yu Sun
?/. - c.23+163C>T r.(=) p.(=) - VUS g.2878256G>A g.2960215G>A - - ARSE_000055 - - - - Germline - - - - - Yu Sun
?/. - c.23+163C>T r.(=) p.(=) - VUS g.2878256G>A g.2960215G>A - - ARSE_000055 - - - - Germline - - - - - Yu Sun
?/. - c.23+185G>A r.(=) p.(=) - VUS g.2878234C>T g.2960193C>T - - ARSE_000054 - - - - Germline - - - - - Yu Sun
+/. 3 c.36G>C r.(?) p.(R12S) - pathogenic g.2876464C>G g.2958423C>G - - ARSE_000001 - PubMed: Franco Cell. 1995; OMIM:var0001 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 3 c.36G>C r.(?) p.(R12S) - pathogenic g.2876464C>G g.2958423C>G - - ARSE_000001 - PubMed: Dahl 1999 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 3 c.36G>C r.(?) p.(R12S) - pathogenic g.2876464C>G g.2958423C>G - - ARSE_000001 - PubMed: Dahl 1999 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 3 c.36G>C r.(?) p.(R12S) - pathogenic g.2876464C>G g.2958423C>G - - ARSE_000001 - PubMed: Dahl 1999 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 3 c.36G>C r.(?) p.(R12S) - pathogenic g.2876464C>G g.2958423C>G - - ARSE_000001 - PubMed: Dahl 1999 - - Germline - - - 0 - Claudia Matos-Miranda
+?/. 3 c.36G>C r.(?) p.R12S - likely pathogenic g.2876464C>G g.2958423C>G - - ARSE_000001 - PubMed: Daniele A 1998 - - Germline - - - 0 - Claudia Matos-Miranda
-?/. - c.70A>C r.(?) p.(Ser24Arg) - likely benign g.2876430T>G g.2958389T>G ARSE(NM_001282628.1):c.145A>C (p.S49R) - ARSE_000074 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. - c.74T>A r.(?) p.(Leu25Ter) - pathogenic g.2876426A>T g.2958385A>T ARSE(NM_000047.2):c.74T>A (p.L25*) - ARSE_000073 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
?/. 3 c.78A>G r.(?) p.(=) - VUS g.2876422T>C g.2958381T>C - - ARSE_000042 - - - rs35718384 Germline - 0.10 - 0 - Claudia Matos-Miranda
+/. 3 c.119T>G r.(?) p.(I40S) - pathogenic g.2876381A>C g.2958340A>C - - ARSE_000022 - PubMed: Nino 2008 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 3 c.119T>G r.(?) p.(I40S) - pathogenic g.2876381A>C g.2958340A>C - - ARSE_000022 - PubMed: Nino 2008 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 3 c.119T>G r.(?) p.(I40S) - pathogenic g.2876381A>C g.2958340A>C - - ARSE_000022 - PubMed: Nino 2008 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 3 c.126_128del r.(?) p.(Leu43del) - pathogenic g.2876377_2876379del g.2958336_2958338del - - ARSE_000023 - submitted 2009 - - Germline - - - 0 - Gene Dx
+/. 3 c.139G>A r.(?) p.(D47N) - pathogenic g.2876361C>T g.2958320C>T - - ARSE_000024 - submitted 2009 - - Germline - - - 0 - Gene Dx
+/. 3 c.169G>A r.(?) p.(G57S) - pathogenic g.2876331C>T g.2958290C>T - - ARSE_000025 - PubMed: Nino 2008 - - Germline - - - 0 - Claudia Matos-Miranda
?/. - c.186-267G>T r.(=) p.(=) - VUS g.2873845C>A g.2955804C>A - - ARSE_000051 - - - - Germline - - - - - Yu Sun
?/. - c.186-267G>T r.(=) p.(=) - VUS g.2873845C>A g.2955804C>A - - ARSE_000051 - - - - Germline - - - - - Yu Sun
-?/. - c.216C>T r.(?) p.(Asp72=) - likely benign g.2873548G>A g.2955507G>A ARSE(NM_001282628.1):c.291C>T (p.D97=) - ARSE_000094 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 4 c.217G>A r.(?) p.(G73S) - pathogenic g.2873547C>T g.2955506C>T - - ARSE_000026 - submitted 2009 - - Germline - - - 0 - Gene Dx
+/. 4 c.217G>A r.(?) p.(G73S) - pathogenic g.2873547C>T g.2955506C>T - - ARSE_000026 - submitted 2009 - - Germline - - - 0 - Gene Dx
-?/. - c.220G>A r.(?) p.(Val74Met) - likely benign g.2873544C>T g.2955503C>T ARSE(NM_001282628.1):c.295G>A (p.V99M) - ARSE_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 4 c.239T>A r.(?) p.(I80N) - pathogenic g.2873525A>T g.2955484A>T - - ARSE_000014 - PubMed: Brunetti-Pierri 2003 - - Germline - - - 0 - Claudia Matos-Miranda
+?/. 4 c.239T>A r.(?) p.I80N - likely pathogenic g.2873525A>T g.2955484A>T - - ARSE_000014 - PubMed: Brunetti-Pierri 2003 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 4 c.268A>G r.(?) p.(R90G) - pathogenic g.2873496T>C g.2955455T>C - - ARSE_000027 - submitted 2009 - - Germline - - - 0 - Gene Dx
?/. - c.308-168C>T r.(=) p.(=) - VUS g.2871474G>A g.2953433G>A - - ARSE_000048 - - - - Germline - - - - - Yu Sun
?/. - c.308-168C>T r.(=) p.(=) - VUS g.2871474G>A g.2953433G>A - - ARSE_000048 - - - - Germline - - - - - Yu Sun
+/. 5 c.316dup r.(?) p.(Ser106PhefsTer21) - pathogenic g.2871300dup g.2953259dup - - ARSE_000015 - PubMed: Brunetti-Pierri 2003 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 5 c.332G>C r.(?) p.(R111P) - pathogenic g.2871282C>G g.2953241C>G - - ARSE_000005 - PubMed: Franco Cell. 1995; OMIM:var0003 - - Germline - - - 0 - Claudia Matos-Miranda
+?/. 5 c.332G>C r.(?) p.R111P - likely pathogenic g.2871282C>G g.2953241C>G - - ARSE_000005 - PubMed: Daniele A 1998 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 5 c.349G>A r.(?) p.(G117R) - pathogenic g.2871265C>T g.2953224C>T - - ARSE_000002 - PubMed: Franco Cell. 1995; OMIM:var0002 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 5 c.359G>A r.(?) p.(G120E) - pathogenic g.2871255C>T g.2953214C>T - - ARSE_000028 - submitted 2009 - - Germline - - - 0 - Gene Dx
+/. 5 c.410G>C r.(?) p.(G137A) - pathogenic g.2871204C>G g.2953163C>G - - ARSE_000007 - PubMed: Sheffield 1998 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 5 c.410G>C r.(?) p.(G137A) - pathogenic g.2871204C>G g.2953163C>G - - ARSE_000007 - PubMed: Sheffield 1998 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 5 c.410G>C r.(?) p.(G137A) - pathogenic g.2871204C>G g.2953163C>G - - ARSE_000007 - PubMed: Sheffield 1998 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 5 c.410G>C r.(?) p.(G137A) - pathogenic g.2871204C>G g.2953163C>G - - ARSE_000007 - PubMed: Nino 2008 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 5 c.410G>C r.(?) p.(G137A) - pathogenic g.2871204C>G g.2953163C>G - - ARSE_000007 - PubMed: Nino 2008 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 5 c.410G>T r.(?) p.(G137V) - pathogenic g.2871204C>A g.2953163C>A - - ARSE_000003 - PubMed: Franco Cell. 1995; OMIM:var0004 - - Germline - - - 0 - Claudia Matos-Miranda
+?/. 5 c.410G>T r.(?) p.G137V - likely pathogenic g.2871204C>A g.2953163C>A - - ARSE_000003 - PubMed: Daniele A 1998 - - Germline - - - 0 - Claudia Matos-Miranda
+/. - c.410G>T r.(?) p.(Gly137Val) - pathogenic g.2871204C>A g.2953163C>A ARSE(NM_000047.2):c.410G>T (p.(Gly137Val)) - ARSE_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.430+8C>T r.(=) p.(=) - likely benign g.2871176G>A g.2953135G>A ARSE(NM_000047.2):c.430+8C>T (p.(=)) - ARSE_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.430+173C>G r.(=) p.(=) - VUS g.2871011G>C g.2952970G>C - - ARSE_000045 - - - - Germline - - - - - Yu Sun
?/. - c.430+173C>G r.(=) p.(=) - VUS g.2871011G>C g.2952970G>C - - ARSE_000045 - - - - Germline - - - - - Yu Sun
+/. 6 c.445G>T r.(?) p.(G149C) - pathogenic g.2867754C>A g.2949713C>A - - ARSE_000029 - submitted 2010 - - Germline - - - 0 - Gene Dx
-?/. - c.467G>A r.(?) p.(Ser156Asn) - likely benign g.2867732C>T g.2949691C>T ARSE(NM_001282628.1):c.542G>A (p.S181N) - ARSE_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.467G>A r.(?) p.(Ser156Asn) - likely benign g.2867732C>T g.2949691C>T ARSE(NM_001282628.1):c.542G>A (p.S181N) - ARSE_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. 6 c.495T>C r.(?) p.(=) - likely benign g.2867704A>G g.2949663A>G H165H - ARSE_000030 recurrent, found 4 times PubMed: Tarpey 2009 - - Germline - - - 0 - Lucy Raymond
?/. 6 c.495T>C r.(?) p.(=) - VUS g.2867704A>G g.2949663A>G - - ARSE_000030 - - - rs35274634 Germline - 0.01 - 0 - Claudia Matos-Miranda
?/. - c.520C>G r.(?) p.(Pro174Ala) - VUS g.2867679G>C g.2949638G>C ARSE(NM_001282628.1):c.595C>G (p.P199A) - ARSE_000093 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 6 c.548G>A r.(?) p.(R183H) - VUS g.2867651C>T g.2949610C>T - - ARSE_000031 nonrecurrent change found once PubMed: Tarpey 2009 - - Germline - - - 0 - Lucy Raymond
?/. 6 c.548G>A r.(?) p.(R183H) - VUS g.2867651C>T g.2949610C>T - - ARSE_000031 - - - rs34412194 Germline - 0.00-0.06 - 0 - Claudia Matos-Miranda
-?/. - c.548G>A r.(?) p.(Arg183His) - likely benign g.2867651C>T g.2949610C>T ARSE(NM_000047.2):c.548G>A (p.(Arg183His)) - ARSE_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 6 c.549C>T r.(?) p.(=) - VUS g.2867650G>A g.2949609G>A - - ARSE_000041 - - - rs5982618 Germline - 0.00-0.08 - 0 - Claudia Matos-Miranda
?/. - c.632_652dup r.(?) p.(Leu211_Thr217dup) - VUS g.2867554_2867574dup g.2949513_2949533dup ARSE(NM_001282628.1):c.707_727dupTGGTAGCAGGGAAGCTCACAC (p.L236_T242dup) - ARSE_000085 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.650C>T r.(?) p.(Thr217Ile) - likely benign g.2867549G>A g.2949508G>A ARSE(NM_001282628.1):c.725C>T (p.T242I) - ARSE_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.715G>A r.(?) p.(Ala239Thr) - likely benign g.2867484C>T g.2949443C>T ARSE(NM_001282628.1):c.790G>A (p.A264T) - ARSE_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.728T>C r.(?) p.(Phe243Ser) - likely benign g.2867471A>G g.2949430A>G ARSE(NM_001282628.1):c.803T>C (p.F268S) - ARSE_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. 6 c.733G>C r.(?) p.(G245R) - pathogenic g.2867466C>G g.2949425C>G - - ARSE_000004 - PubMed: Franco Cell. 1995; OMIM:var0005 - - Germline - - - 0 - Claudia Matos-Miranda
+?/. 6 c.733G>C r.(?) p.G245R - likely pathogenic g.2867466C>G g.2949425C>G - - ARSE_000004 - PubMed: Daniele A 1998 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 6 c.767dup r.(?) p.(Met256IlefsTer32) - pathogenic g.2867432dup g.2949391dup - - ARSE_000032 - PubMed: Nino 2008 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 6 c.767dup r.(?) p.(Met256IlefsTer32) - pathogenic g.2867432dup g.2949391dup - - ARSE_000032 - PubMed: Nino 2008 - - Germline - - - 0 - Claudia Matos-Miranda
-?/. 6 c.786G>A r.(?) p.(=) - likely benign g.2867413C>T g.2949372C>T T262T - ARSE_000033 recurrent, found 6 times PubMed: Tarpey 2009 - - Germline - - - 0 - Lucy Raymond
?/. 6 c.786G>A r.(?) p.(=) - VUS g.2867413C>T g.2949372C>T T262T - ARSE_000033 - - - rs17325750 Germline - 0.00-0.08 - 0 - Claudia Matos-Miranda
-?/. - c.827T>A r.(?) p.(Leu276Gln) - likely benign g.2867372A>T g.2949331A>T ARSE(NM_001282628.1):c.902T>A (p.L301Q) - ARSE_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.840G>A r.(?) p.(Ala280=) - likely benign g.2867359C>T g.2949318C>T ARSE(NM_001282628.1):c.915G>A (p.A305=) - ARSE_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.855-198_855-189del r.(=) p.(=) - VUS g.2864378_2864387del g.2946337_2946346del - - ARSE_000044 - - - - Germline - - - - - Yu Sun
?/. - c.855-198_855-189del r.(=) p.(=) - VUS g.2864378_2864387del g.2946337_2946346del - - ARSE_000044 - - - - Germline - - - - - Yu Sun
?/. - c.855-197_855-189del r.(=) p.(=) - VUS g.2864379_2864387del g.2946338_2946346del - - ARSE_000043 - - - - Germline - - - - - Yu Sun
?/. - c.855-197_855-189del r.(=) p.(=) - VUS g.2864379_2864387del g.2946338_2946346del - - ARSE_000043 - - - - Germline - - - - - Yu Sun
?/. - c.855-196_855-188del r.(=) p.(=) - VUS g.2864363_2864371del g.2946322_2946330del - - ARSE_000060 - - - - Germline - - - - - Yu Sun
+/. 6i_10i c.855-?_1411+?del r.(?) p.(del) - pathogenic g.2854783_2864175del g.2936742_2946134del - - ARSE_000034 deletion exons 7-10 Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message. PubMed: Casarin 2009 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 6i_10i c.855-?_1411+?del r.(?) p.(del) - pathogenic g.2854783_2864175del g.2936742_2946134del - - ARSE_000034 deletion exons 7-10 Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message. PubMed: Casarin 2009 - - Germline - - - 0 - Claudia Matos-Miranda
+/. 6i_10i c.855-?_1411+?del r.(?) p.(del) - pathogenic g.2854783_2864175del g.2936742_2946134del - - ARSE_000034 deletion exons 7-10 Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message. PubMed: Casarin 2009 - - Germline - - - 0 - Claudia Matos-Miranda
-?/. - c.897C>T r.(?) p.(His299=) - likely benign g.2864133G>A - ARSE(NM_001282628.1):c.972C>T (p.H324=) - ARSE_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.898G>A r.(?) p.(Val300Ile) - likely benign g.2864132C>T g.2946091C>T ARSE(NM_000047.2):c.898G>A (p.(Val300Ile)) - ARSE_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
+/. 7 c.916A>G r.(?) p.(T306A) - pathogenic g.2864114T>C g.2946073T>C - - ARSE_000035 - submitted 2009 - - Germline - - - 0 - Gene Dx
?/. - c.934G>A r.(?) p.(Gly312Arg) - VUS g.2864096C>T g.2946055C>T ARSE(NM_001282628.1):c.1009G>A (p.G337R) - ARSE_000092 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 07 c.949G>A r.(?) p.(G317R) - pathogenic g.2864081C>T g.2946040C>T - - ARSE_000008 - PubMed: Sheffield 1998 - - Germline - - - 0 - Claudia Matos-Miranda
Legend   « First ‹ Prev     1 2     Next › Last »