Full data view for gene ARSE

Information The variants shown are described using the NM_000047.2 transcript reference sequence.

163 entries on 2 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2     Next › Last »



AscendingDNA change (cDNA)     

RNA change     



Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     



















Age at death     




Panel size     

+/. _1_2i c.(?_-21)_23+?del r.(?) p.0? Parent #1 - - g.? - - - ARSE_000021 deletion exons 1-2 PubMed: Nino 2008 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+/. _1_2i c.(?_-21)_23+?del r.(?) p.0? Parent #1 - - g.? - - - ARSE_000021 deletion exons 1-2 PubMed: Nino 2008 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, mother of 0047 F - - - - 0 - - 1 Claudia Matos-Miranda
-/. - c.-10G>C r.(?) p.(=) Unknown - benign g.2878451C>G - ARSE(NM_001282631.1):c.18G>C (p.E6D) - ARSE_000075 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 Parent #1 - - g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Gene Dx
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 Parent #1 - - g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, mother of 0075 F - - - - 0 - - 1 Gene Dx
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 Parent #1 - - g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Gene Dx
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 Parent #1 - - g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Gene Dx
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 Parent #1 - - g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene PubMed: Brunetti-Pierri 2003 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 Parent #1 - - g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene PubMed: Brunetti-Pierri 2003 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 Parent #1 - - g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene PubMed: Nino 2008 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 Parent #1 - - g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Gene Dx
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 Parent #1 - - g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, mother of 0071 F - - - - 0 - - 1 Gene Dx
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 Parent #1 - - g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, sister of 0072 F - - - - 0 - - 1 Gene Dx
+/. _1_11_ c.(?_-1)_(*1_?)del r.(?) p.0 Parent #1 - - g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, sister of 0071 F - - - - 0 - - 1 Gene Dx
-?/. - c.23+5G>C r.spl? p.? Unknown - likely benign g.2878414C>G - ARSE(NM_000047.2):c.23+5G>C (p.?) - ARSE_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.23+115G>A - p.(=) Maternal (inferred) - - g.2878304C>T g.2960263C>T - - ARSE_000059 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.23+115G>A - p.(=) Maternal (inferred) - - g.2878304C>T g.2960263C>T - - ARSE_000059 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.23+123A>G - p.(=) Maternal (inferred) - - g.2878296T>C g.2960255T>C - - ARSE_000057 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.23+123A>G - p.(=) Maternal (inferred) - - g.2878296T>C g.2960255T>C - - ARSE_000057 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.23+163C>T - p.(=) Maternal (inferred) - - g.2878256G>A g.2960215G>A - - ARSE_000055 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.23+163C>T - p.(=) Maternal (inferred) - - g.2878256G>A g.2960215G>A - - ARSE_000055 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.23+185G>A - p.(=) Maternal (inferred) - - g.2878234C>T g.2960193C>T - - ARSE_000054 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
+/. 3 c.36G>C r.(?) p.(R12S) Parent #1 - - g.2876464C>G g.2958423C>G - - ARSE_000001 - PubMed: Franco Cell. 1995; OMIM:var0001 - - Germline - - - 0 - DNA SSCA, SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+/. 3 c.36G>C r.(?) p.(R12S) Parent #1 - - g.2876464C>G g.2958423C>G - - ARSE_000001 - PubMed: Dahl 1999 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, mother of 0001 F - - - - 0 - - 1 Claudia Matos-Miranda
+/. 3 c.36G>C r.(?) p.(R12S) Parent #1 - - g.2876464C>G g.2958423C>G - - ARSE_000001 - PubMed: Dahl 1999 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, sister of 0001 F - - - - 0 - - 1 Claudia Matos-Miranda
+/. 3 c.36G>C r.(?) p.(R12S) Parent #1 - - g.2876464C>G g.2958423C>G - - ARSE_000001 - PubMed: Dahl 1999 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, sister of 0001 F - - - - 0 - - 1 Claudia Matos-Miranda
+/. 3 c.36G>C r.(?) p.(R12S) Parent #1 - - g.2876464C>G g.2958423C>G - - ARSE_000001 - PubMed: Dahl 1999 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, sister of 0001 F - - - - 0 - - 1 Claudia Matos-Miranda
+?/. 3 c.36G>C r.(?) p.R12S Unknown - - g.2876464C>G g.2958423C>G - - ARSE_000001 - PubMed: Daniele A 1998 - - Germline - - - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Claudia Matos-Miranda
-?/. - c.70A>C r.(?) p.(Ser24Arg) Unknown - likely benign g.2876430T>G - ARSE(NM_001282628.1):c.145A>C (p.S49R) - ARSE_000074 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.74T>A r.(?) p.(Leu25*) Unknown - pathogenic g.2876426A>T - ARSE(NM_000047.2):c.74T>A (p.L25*) - ARSE_000073 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. 3 c.78A>G r.(?) p.(=) Unknown - - g.2876422T>C g.2958381T>C - - ARSE_000042 - - - rs35718384 Germline - 0.10 - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Claudia Matos-Miranda
+/. 3 c.119T>G r.(?) p.(I40S) Parent #1 - - g.2876381A>C g.2958340A>C - - ARSE_000022 - PubMed: Nino 2008 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+/. 3 c.119T>G r.(?) p.(I40S) Parent #1 - - g.2876381A>C g.2958340A>C - - ARSE_000022 - PubMed: Nino 2008 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - brother of 0036 M - - - - 0 - - 1 Claudia Matos-Miranda
+/. 3 c.119T>G r.(?) p.(I40S) Parent #1 - - g.2876381A>C g.2958340A>C - - ARSE_000022 - PubMed: Nino 2008 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - female carrier, mother of 0036 M - - - - 0 - - 1 Claudia Matos-Miranda
+/. 3 c.126_128delTCT r.(?) p.(Leu43del) Parent #1 - - g.2876372_2876374delAGA g.2958331_2958333delAGA - - ARSE_000023 - submitted 2009 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Gene Dx
+/. 3 c.139G>A r.(?) p.(D47N) Parent #1 - - g.2876361C>T g.2958320C>T - - ARSE_000024 - submitted 2009 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Gene Dx
+/. 3 c.169G>A r.(?) p.(G57S) Parent #1 - - g.2876331C>T g.2958290C>T - - ARSE_000025 - PubMed: Nino 2008 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
?/. - c.186-267G>T - p.(=) Maternal (inferred) - - g.2873845C>A g.2955804C>A - - ARSE_000051 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.186-267G>T - p.(=) Maternal (inferred) - - g.2873845C>A g.2955804C>A - - ARSE_000051 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-?/. - c.216C>T r.(?) p.(=) Unknown - likely benign g.2873548G>A - ARSE(NM_001282628.1):c.291C>T (p.D97=) - ARSE_000094 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 4 c.217G>A r.(?) p.(G73S) Parent #1 - - g.2873547C>T g.2955506C>T - - ARSE_000026 - submitted 2009 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Gene Dx
+/. 4 c.217G>A r.(?) p.(G73S) Parent #1 - - g.2873547C>T g.2955506C>T - - ARSE_000026 - submitted 2009 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, mother of 0055 F - - - - 0 - - 1 Gene Dx
-?/. - c.220G>A r.(?) p.(Val74Met) Unknown - likely benign g.2873544C>T - ARSE(NM_001282628.1):c.295G>A (p.V99M) - ARSE_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 4 c.239T>A r.(?) p.(I80N) Parent #1 - - g.2873525A>T g.2955484A>T - - ARSE_000014 - PubMed: Brunetti-Pierri 2003 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+?/. 4 c.239T>A r.(?) p.I80N Unknown - - g.2873525A>T g.2955484A>T - - ARSE_000014 - PubMed: Brunetti-Pierri 2003 - - Germline - - - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Claudia Matos-Miranda
+/. 4 c.268A>G r.(?) p.(R90G) Parent #1 - - g.2873496T>C g.2955455T>C - - ARSE_000027 - submitted 2009 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Gene Dx
?/. - c.308-168C>T - p.(=) Maternal (inferred) - - g.2871474G>A g.2953433G>A - - ARSE_000048 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.308-168C>T - p.(=) Maternal (inferred) - - g.2871474G>A g.2953433G>A - - ARSE_000048 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
+/. 5 c.314dupT r.(?) p.(104fs22*) Parent #1 - - g.2871300dupA g.2953259dupA - - ARSE_000015 - PubMed: Brunetti-Pierri 2003 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+/. 5 c.332G>C r.(?) p.(R111P) Parent #1 - - g.2871282C>G g.2953241C>G - - ARSE_000005 - PubMed: Franco Cell. 1995; OMIM:var0003 - - Germline - - - 0 - DNA SSCA, SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+?/. 5 c.332G>C r.(?) p.R111P Unknown - - g.2871282C>G g.2953241C>G - - ARSE_000005 - PubMed: Daniele A 1998 - - Germline - - - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Claudia Matos-Miranda
+/. 5 c.349G>A r.(?) p.(G117R) Parent #1 - - g.2871265C>T g.2953224C>T - - ARSE_000002 - PubMed: Franco Cell. 1995; OMIM:var0002 - - Germline - - - 0 - DNA SSCA, SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+/. 5 c.359G>A r.(?) p.(G120E) Parent #1 - - g.2871255C>T g.2953214C>T - - ARSE_000028 - submitted 2009 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Gene Dx
+/. 5 c.410G>C r.(?) p.(G137A) Parent #1 - - g.2871204C>G g.2953163C>G - - ARSE_000007 - PubMed: Sheffield 1998 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+/. 5 c.410G>C r.(?) p.(G137A) Parent #1 - - g.2871204C>G g.2953163C>G - - ARSE_000007 - PubMed: Sheffield 1998 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - maternal grandfather of 0007 M - - - - 0 - - 1 Claudia Matos-Miranda
+/. 5 c.410G>C r.(?) p.(G137A) Parent #1 - - g.2871204C>G g.2953163C>G - - ARSE_000007 - PubMed: Sheffield 1998 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, mother of 0007 F - - - - 0 - - 1 Claudia Matos-Miranda
+/. 5 c.410G>C r.(?) p.(G137A) Parent #1 - - g.2871204C>G g.2953163C>G - - ARSE_000007 - PubMed: Nino 2008 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+/. 5 c.410G>C r.(?) p.(G137A) Parent #1 - - g.2871204C>G g.2953163C>G - - ARSE_000007 - PubMed: Nino 2008 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, mother of 0040 F - - - - 0 - - 1 Claudia Matos-Miranda
+/. 5 c.410G>T r.(?) p.(G137V) Parent #1 - - g.2871204C>A g.2953163C>A - - ARSE_000003 - PubMed: Franco Cell. 1995; OMIM:var0004 - - Germline - - - 0 - DNA SSCA, SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+?/. 5 c.410G>T r.(?) p.G137V Unknown - - g.2871204C>A g.2953163C>A - - ARSE_000003 - PubMed: Daniele A 1998 - - Germline - - - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Claudia Matos-Miranda
+/. - c.410G>T r.(?) p.(Gly137Val) Unknown - pathogenic g.2871204C>A - ARSE(NM_000047.2):c.410G>T (p.(Gly137Val)) - ARSE_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.430+173C>G - p.(=) Maternal (inferred) - - g.2871011G>C g.2952970G>C - - ARSE_000045 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.430+173C>G - p.(=) Maternal (inferred) - - g.2871011G>C g.2952970G>C - - ARSE_000045 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
+/. 6 c.445G>T r.(?) p.(G149C) Parent #1 - - g.2867754C>A g.2949713C>A - - ARSE_000029 - submitted 2010 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Gene Dx
-?/. - c.467G>A r.(?) p.(Ser156Asn) Unknown - likely benign g.2867732C>T - ARSE(NM_001282628.1):c.542G>A (p.S181N) - ARSE_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.467G>A r.(?) p.(Ser156Asn) Unknown - likely benign g.2867732C>T - ARSE(NM_001282628.1):c.542G>A (p.S181N) - ARSE_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. 6 c.495T>C r.(?) p.(=) Parent #1 - - g.2867704A>G g.2949663A>G H165H - ARSE_000030 recurrent, found 4 times PubMed: Tarpey 2009 - - Germline - - - 0 - DNA SEQ - - MRX;IDX 19377244-Pat? PubMed: Tarpey 2009 for details contact Lucy Raymond (flr24 @ cam.ac.uk) ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 4 Lucy Raymond
?/. 6 c.495T>C r.(?) p.(=) Unknown - - g.2867704A>G g.2949663A>G - - ARSE_000030 - - - rs35274634 Germline - 0.01 - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Claudia Matos-Miranda
?/. - c.520C>G r.(?) p.(Pro174Ala) Unknown - VUS g.2867679G>C - ARSE(NM_001282628.1):c.595C>G (p.P199A) - ARSE_000093 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 6 c.548G>A r.(?) p.(R183H) Parent #1 - - g.2867651C>T g.2949610C>T - - ARSE_000031 nonrecurrent change found once PubMed: Tarpey 2009 - - Germline - - - 0 - DNA SEQ - - MRX;IDX 19377245-Pat? PubMed: Tarpey 2009 for details contact Lucy Raymond (flr24 @ cam.ac.uk) ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 1 Lucy Raymond
?/. 6 c.548G>A r.(?) p.(R183H) Unknown - - g.2867651C>T g.2949610C>T - - ARSE_000031 - - - rs34412194 Germline - 0.00-0.06 - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Claudia Matos-Miranda
-?/. - c.548G>A r.(?) p.(Arg183His) Unknown - likely benign g.2867651C>T - ARSE(NM_000047.2):c.548G>A (p.(Arg183His)) - ARSE_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 6 c.549C>T r.(?) p.(=) Unknown - - g.2867650G>A g.2949609G>A - - ARSE_000041 - - - rs5982618 Germline - 0.00-0.08 - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Claudia Matos-Miranda
?/. - c.632_652dup r.(?) p.(Leu211_Thr217dup) Unknown - VUS g.2867554_2867574dup - ARSE(NM_001282628.1):c.707_727dupTGGTAGCAGGGAAGCTCACAC (p.L236_T242dup) - ARSE_000085 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.650C>T r.(?) p.(Thr217Ile) Unknown - likely benign g.2867549G>A - ARSE(NM_001282628.1):c.725C>T (p.T242I) - ARSE_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.715G>A r.(?) p.(Ala239Thr) Unknown - likely benign g.2867484C>T - ARSE(NM_001282628.1):c.790G>A (p.A264T) - ARSE_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.728T>C r.(?) p.(Phe243Ser) Unknown - likely benign g.2867471A>G - ARSE(NM_001282628.1):c.803T>C (p.F268S) - ARSE_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. 6 c.733G>C r.(?) p.(G245R) Parent #1 - - g.2867466C>G g.2949425C>G - - ARSE_000004 - PubMed: Franco Cell. 1995; OMIM:var0005 - - Germline - - - 0 - DNA SSCA, SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+?/. 6 c.733G>C r.(?) p.G245R Unknown - - g.2867466C>G g.2949425C>G - - ARSE_000004 - PubMed: Daniele A 1998 - - Germline - - - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Claudia Matos-Miranda
+/. 6 c.767dupT r.(?) p.(255fs32*) Parent #1 - - g.2867432dupA g.2949391dupA - - ARSE_000032 - PubMed: Nino 2008 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+/. 6 c.767dupT r.(?) p.(255fs32*) Parent #1 - - g.2867432dupA g.2949391dupA - - ARSE_000032 - PubMed: Nino 2008 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, mother of 0042 F - - - - 0 - - 1 Claudia Matos-Miranda
-?/. 6 c.786G>A r.(?) p.(=) Parent #1 - - g.2867413C>T g.2949372C>T T262T - ARSE_000033 recurrent, found 6 times PubMed: Tarpey 2009 - - Germline - - - 0 - DNA SEQ - - MRX;IDX 19377246-Pat? PubMed: Tarpey 2009 for details contact Lucy Raymond (flr24 @ cam.ac.uk) ? - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 6 Lucy Raymond
?/. 6 c.786G>A r.(?) p.(=) Unknown - - g.2867413C>T g.2949372C>T T262T - ARSE_000033 - - - rs17325750 Germline - 0.00-0.08 - 0 - DNA SEQ - - ? - - - - - - - - 0 - - 1 Claudia Matos-Miranda
?/. - c.827T>A r.(?) p.(Leu276Gln) Unknown - VUS g.2867372A>T - ARSE(NM_001282628.1):c.902T>A (p.L301Q) - ARSE_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.840G>A r.(?) p.(=) Unknown - likely benign g.2867359C>T - ARSE(NM_001282628.1):c.915G>A (p.A305=) - ARSE_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.855-212_855-204del - p.(=) Unknown - - g.2864379_2864387del g.2946338_2946346del - - ARSE_000043 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.855-212_855-204del - p.(=) Unknown - - g.2864379_2864387del g.2946338_2946346del - - ARSE_000043 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.855-212_855-203del - p.(=) Unknown - - g.2864378_2864387del g.2946337_2946346del - - ARSE_000044 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.855-212_855-203del - p.(=) Unknown - - g.2864378_2864387del g.2946337_2946346del - - ARSE_000044 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.855-196_855-188del - p.(=) Maternal (inferred) - - g.2864363_2864371del g.2946322_2946330del - - ARSE_000060 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
+/. 6i_10i c.855-?_1411+?del r.(?) p.(del) Parent #1 - - g.2854783_2864175del g.2936742_2946134del - - ARSE_000034 deletion exons 7-10 PubMed: Casarin 2009 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+/. 6i_10i c.855-?_1411+?del r.(?) p.(del) Parent #1 - - g.2854783_2864175del g.2936742_2946134del - - ARSE_000034 deletion exons 7-10 PubMed: Casarin 2009 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - maternal grandfather of 0050 M - - - - 0 - - 1 Claudia Matos-Miranda
+/. 6i_10i c.855-?_1411+?del r.(?) p.(del) Parent #1 - - g.2854783_2864175del g.2936742_2946134del - - ARSE_000034 deletion exons 7-10 PubMed: Casarin 2009 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, mother of 0050 F - - - - 0 - - 1 Claudia Matos-Miranda
-?/. - c.898G>A r.(?) p.(Val300Ile) Unknown - likely benign g.2864132C>T - ARSE(NM_000047.2):c.898G>A (p.(Val300Ile)) - ARSE_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. 7 c.916A>G r.(?) p.(T306A) Parent #1 - - g.2864114T>C g.2946073T>C - - ARSE_000035 - submitted 2009 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Gene Dx
?/. - c.934G>A r.(?) p.(Gly312Arg) Unknown - VUS g.2864096C>T - ARSE(NM_001282628.1):c.1009G>A (p.G337R) - ARSE_000092 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 07 c.949G>A r.(?) p.(G317R) Parent #1 - - g.2864081C>T g.2946040C>T - - ARSE_000008 - PubMed: Sheffield 1998 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Claudia Matos-Miranda
+/. 07 c.949G>A r.(?) p.(G317R) Parent #1 - - g.2864081C>T g.2946040C>T - - ARSE_000008 - PubMed: Sheffield 1998 - - Germline - - - 0 - DNA SEQ - - ? - - Female carrier, mother of 0010 F - - - - 0 - - 1 Claudia Matos-Miranda
+/. 07 c.949G>A r.(?) p.(G317R) Parent #1 - - g.2864081C>T g.2946040C>T - - ARSE_000008 - submitted 2009 - - Germline - - - 0 - DNA SEQ - - CPDX-1 - - - M - - - - 0 - - 1 Gene Dx
+?/. - c.949G>A r.(?) p.(Gly317Arg) Unknown - likely pathogenic g.2864081C>T - - - ARSE_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
Legend   « First ‹ Prev     1 2     Next › Last »