Unique variants in gene ARSE

Information The variants shown are described using the NM_000047.2 transcript reference sequence.

82 entries on 1 page. Showing entries 1 - 82.
Legend  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. 2 _1_2i c.(?_-21)_23+?del - r.(?) p.0? g.? - - - ARSE_000021 deletion exons 1-2 PubMed: Nino 2008 - - Germline - - - - - Claudia Matos-Miranda
-?/. 1 - c.-20-5T>C likely benign r.spl? p.? g.2878466A>G - ARSE(NM_000047.2):c.-20-5T>C (p.(=)) - ARSE_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 - c.-10G>C benign r.(?) p.(=) g.2878451C>G - ARSE(NM_001282631.1):c.18G>C (p.E6D) - ARSE_000075 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 11 _1_11_ c.(?_-1)_(*1_?)del - r.(?) p.0 g.(?_2852872)_(2878442_?)del - - - ARSE_000020 deletion full ARSE gene submitted 2009, PubMed: Brunetti-Pierri 2003, PubMed: Nino 2008 - - Germline - - - - - Gene Dx, Claudia Matos-Miranda
-?/. 1 - c.23+5G>C likely benign r.spl? p.? g.2878414C>G - ARSE(NM_000047.2):c.23+5G>C (p.?) - ARSE_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 2 - c.23+115G>A - - p.(=) g.2878304C>T g.2960263C>T - - ARSE_000059 - - - - Germline - - - - - Yu Sun
?/. 2 - c.23+123A>G - - p.(=) g.2878296T>C g.2960255T>C - - ARSE_000057 - - - - Germline - - - - - Yu Sun
?/. 2 - c.23+163C>T - - p.(=) g.2878256G>A g.2960215G>A - - ARSE_000055 - - - - Germline - - - - - Yu Sun
?/. 1 - c.23+185G>A - - p.(=) g.2878234C>T g.2960193C>T - - ARSE_000054 - - - - Germline - - - - - Yu Sun
+/., +?/. 6 3 c.36G>C - r.(?) p.(R12S), p.R12S g.2876464C>G g.2958423C>G - - ARSE_000001 - PubMed: Franco Cell. 1995; OMIM:var0001, PubMed: Dahl 1999, PubMed: Daniele A 1998 - - Germline - - - - - Claudia Matos-Miranda
-?/. 1 - c.70A>C likely benign r.(?) p.(Ser24Arg) g.2876430T>G - ARSE(NM_001282628.1):c.145A>C (p.S49R) - ARSE_000074 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 - c.74T>A pathogenic r.(?) p.(Leu25*) g.2876426A>T - ARSE(NM_000047.2):c.74T>A (p.L25*) - ARSE_000073 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 1 3 c.78A>G - r.(?) p.(=) g.2876422T>C g.2958381T>C - - ARSE_000042 - - - rs35718384 Germline - 0.10 - - - Claudia Matos-Miranda
+/. 3 3 c.119T>G - r.(?) p.(I40S) g.2876381A>C g.2958340A>C - - ARSE_000022 - PubMed: Nino 2008 - - Germline - - - - - Claudia Matos-Miranda
+/. 1 3 c.126_128delTCT - r.(?) p.(Leu43del) g.2876372_2876374delAGA g.2958331_2958333delAGA - - ARSE_000023 - submitted 2009 - - Germline - - - - - Gene Dx
+/. 1 3 c.139G>A - r.(?) p.(D47N) g.2876361C>T g.2958320C>T - - ARSE_000024 - submitted 2009 - - Germline - - - - - Gene Dx
+/. 1 3 c.169G>A - r.(?) p.(G57S) g.2876331C>T g.2958290C>T - - ARSE_000025 - PubMed: Nino 2008 - - Germline - - - - - Claudia Matos-Miranda
?/. 2 - c.186-267G>T - - p.(=) g.2873845C>A g.2955804C>A - - ARSE_000051 - - - - Germline - - - - - Yu Sun
+/. 2 4 c.217G>A - r.(?) p.(G73S) g.2873547C>T g.2955506C>T - - ARSE_000026 - submitted 2009 - - Germline - - - - - Gene Dx
-?/. 1 - c.220G>A likely benign r.(?) p.(Val74Met) g.2873544C>T - ARSE(NM_001282628.1):c.295G>A (p.V99M) - ARSE_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/., +?/. 2 4 c.239T>A - r.(?) p.(I80N), p.I80N g.2873525A>T g.2955484A>T - - ARSE_000014 - PubMed: Brunetti-Pierri 2003 - - Germline - - - - - Claudia Matos-Miranda
+/. 1 4 c.268A>G - r.(?) p.(R90G) g.2873496T>C g.2955455T>C - - ARSE_000027 - submitted 2009 - - Germline - - - - - Gene Dx
?/. 2 - c.308-168C>T - - p.(=) g.2871474G>A g.2953433G>A - - ARSE_000048 - - - - Germline - - - - - Yu Sun
+/. 1 5 c.314dupT - r.(?) p.(104fs22*) g.2871300dupA g.2953259dupA - - ARSE_000015 - PubMed: Brunetti-Pierri 2003 - - Germline - - - - - Claudia Matos-Miranda
+/., +?/. 2 5 c.332G>C - r.(?) p.(R111P), p.R111P g.2871282C>G g.2953241C>G - - ARSE_000005 - PubMed: Franco Cell. 1995; OMIM:var0003, PubMed: Daniele A 1998 - - Germline - - - - - Claudia Matos-Miranda
+/. 1 5 c.349G>A - r.(?) p.(G117R) g.2871265C>T g.2953224C>T - - ARSE_000002 - PubMed: Franco Cell. 1995; OMIM:var0002 - - Germline - - - - - Claudia Matos-Miranda
+/. 1 5 c.359G>A - r.(?) p.(G120E) g.2871255C>T g.2953214C>T - - ARSE_000028 - submitted 2009 - - Germline - - - - - Gene Dx
+/. 5 5 c.410G>C - r.(?) p.(G137A) g.2871204C>G g.2953163C>G - - ARSE_000007 - PubMed: Sheffield 1998, PubMed: Nino 2008 - - Germline - - - - - Claudia Matos-Miranda
+/., +?/. 3 5 c.410G>T pathogenic r.(?) p.(G137V), p.G137V, p.(Gly137Val) g.2871204C>A g.2953163C>A ARSE(NM_000047.2):c.410G>T (p.(Gly137Val)) - ARSE_000003 VKGL data sharing initiative Nederland PubMed: Franco Cell. 1995; OMIM:var0004, PubMed: Daniele A 1998 - - Germline, CLASSIFICATION record - - - - - Claudia Matos-Miranda, VKGL-NL
-?/. 1 - c.430+8C>T likely benign r.(=) p.(=) g.2871176G>A - ARSE(NM_000047.2):c.430+8C>T (p.(=)) - ARSE_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 2 - c.430+173C>G - - p.(=) g.2871011G>C g.2952970G>C - - ARSE_000045 - - - - Germline - - - - - Yu Sun
+/. 1 6 c.445G>T - r.(?) p.(G149C) g.2867754C>A g.2949713C>A - - ARSE_000029 - submitted 2010 - - Germline - - - - - Gene Dx
-?/. 2 - c.467G>A likely benign r.(?) p.(Ser156Asn) g.2867732C>T - ARSE(NM_001282628.1):c.542G>A (p.S181N) - ARSE_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
-?/., ?/. 2 6 c.495T>C - r.(?) p.(=) g.2867704A>G g.2949663A>G H165H - ARSE_000030 recurrent, found 4 times PubMed: Tarpey 2009 - rs35274634 Germline - 0.01 - - - Lucy Raymond, Claudia Matos-Miranda
?/., -?/. 3 6 c.548G>A likely benign r.(?) p.(R183H), p.(Arg183His) g.2867651C>T g.2949610C>T ARSE(NM_000047.2):c.548G>A (p.(Arg183His)) - ARSE_000031 nonrecurrent change found once, VKGL data sharing initiative Nederland PubMed: Tarpey 2009 - rs34412194 Germline, CLASSIFICATION record - 0.00-0.06 - - - Lucy Raymond, Claudia Matos-Miranda, VKGL-NL
?/. 1 6 c.549C>T - r.(?) p.(=) g.2867650G>A g.2949609G>A - - ARSE_000041 - - - rs5982618 Germline - 0.00-0.08 - - - Claudia Matos-Miranda
?/. 1 - c.632_652dup VUS r.(?) p.(Leu211_Thr217dup) g.2867554_2867574dup - ARSE(NM_001282628.1):c.707_727dupTGGTAGCAGGGAAGCTCACAC (p.L236_T242dup) - ARSE_000085 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.650C>T likely benign r.(?) p.(Thr217Ile) g.2867549G>A - ARSE(NM_001282628.1):c.725C>T (p.T242I) - ARSE_000071 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.715G>A likely benign r.(?) p.(Ala239Thr) g.2867484C>T - ARSE(NM_001282628.1):c.790G>A (p.A264T) - ARSE_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.728T>C likely benign r.(?) p.(Phe243Ser) g.2867471A>G - ARSE(NM_001282628.1):c.803T>C (p.F268S) - ARSE_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/., +?/. 2 6 c.733G>C - r.(?) p.(G245R), p.G245R g.2867466C>G g.2949425C>G - - ARSE_000004 - PubMed: Franco Cell. 1995; OMIM:var0005, PubMed: Daniele A 1998 - - Germline - - - - - Claudia Matos-Miranda
+/. 2 6 c.767dupT - r.(?) p.(255fs32*) g.2867432dupA g.2949391dupA - - ARSE_000032 - PubMed: Nino 2008 - - Germline - - - - - Claudia Matos-Miranda
-?/. 1 - c.775C>G likely benign r.(?) p.(His259Asp) g.2867424G>C - ARSE(NM_000047.2):c.775C>G (p.(His259Asp)) - ARSE_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/., ?/. 2 6 c.786G>A - r.(?) p.(=) g.2867413C>T g.2949372C>T T262T - ARSE_000033 recurrent, found 6 times PubMed: Tarpey 2009 - rs17325750 Germline - 0.00-0.08 - - - Lucy Raymond, Claudia Matos-Miranda
?/. 1 - c.827T>A VUS r.(?) p.(Leu276Gln) g.2867372A>T - ARSE(NM_001282628.1):c.902T>A (p.L301Q) - ARSE_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.840G>A likely benign r.(?) p.(=) g.2867359C>T - ARSE(NM_001282628.1):c.915G>A (p.A305=) - ARSE_000068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 2 - c.855-212_855-204del - - p.(=) g.2864379_2864387del g.2946338_2946346del - - ARSE_000043 - - - - Germline - - - - - Yu Sun
?/. 2 - c.855-212_855-203del - - p.(=) g.2864378_2864387del g.2946337_2946346del - - ARSE_000044 - - - - Germline - - - - - Yu Sun
?/. 1 - c.855-196_855-188del - - p.(=) g.2864363_2864371del g.2946322_2946330del - - ARSE_000060 - - - - Germline - - - - - Yu Sun
+/. 3 6i_10i c.855-?_1411+?del - r.(?) p.(del) g.2854783_2864175del g.2936742_2946134del - - ARSE_000034 deletion exons 7-10 PubMed: Casarin 2009 - - Germline - - - - - Claudia Matos-Miranda
-?/. 1 - c.898G>A likely benign r.(?) p.(Val300Ile) g.2864132C>T - ARSE(NM_000047.2):c.898G>A (p.(Val300Ile)) - ARSE_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 7 c.916A>G - r.(?) p.(T306A) g.2864114T>C g.2946073T>C - - ARSE_000035 - submitted 2009 - - Germline - - - - - Gene Dx
+?/., +/. 4 07 c.949G>A likely pathogenic r.(?) p.(Gly317Arg), p.(G317R) g.2864081C>T g.2946040C>T ARSE(NM_000047.2):c.949G>A (p.Gly317Arg) - ARSE_000008 VKGL data sharing initiative Nederland PubMed: Sheffield 1998, submitted 2009 - - CLASSIFICATION record, Germline - - - - - VKGL-NL, Claudia Matos-Miranda, Gene Dx
?/. 2 - c.992-219C>G - - p.(=) g.2861459G>C g.2943418G>C - - ARSE_000049 - - - - Germline - - - - - Yu Sun
-?/. 1 - c.1053G>A likely benign r.(?) p.(=) g.2861179C>T - ARSE(NM_001282628.1):c.1128G>A (p.T376=) - ARSE_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 2 8 c.1063G>A pathogenic r.(?) p.(Gly355Ser), p.(G355S) g.2861169C>T g.2943128C>T ARSE(NM_001282628.1):c.1138G>A (p.G380S) - ARSE_000012 VKGL data sharing initiative Nederland PubMed: Garnier 2007 - - CLASSIFICATION record, Germline - - - - - VKGL-NL, Claudia Matos-Miranda
?/. 1 - c.1063G>C VUS r.(?) p.(Gly355Arg) g.2861169C>G - ARSE(NM_001282628.1):c.1138G>C (p.G380R) - ARSE_000081 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1083A>G likely benign r.(?) p.(=) g.2861149T>C - ARSE(NM_001282628.1):c.1158A>G (p.Q386=) - ARSE_000066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. 1 - c.1126+5G>C likely benign r.spl? p.? g.2861101C>G - ARSE(NM_000047.2):c.1126+5G>C (p.?) - ARSE_000080 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. 2 - c.1127-143_1127-142insAG - - p.(=) g.2856440_2856441insCT g.2938399_2938400insCT - - ARSE_000047 - - - - Germline - - - - - Yu Sun
?/. 2 - c.1127-124_1127-123insGA - - p.(=) g.2856421_2856422insTC g.2938380_2938381insTC - - ARSE_000061 - - - - Germline - - - - - Yu Sun
+/. 3 9 c.1130G>A - r.(?) p.(G377E) g.2856295C>T g.2938254C>T - - ARSE_000013 - submitted 2009 - - Germline - - - - - Gene Dx
+/. 3 9 c.1171G>A pathogenic r.(?) p.(G391R), p.(Gly391Arg) g.2856254C>T g.2938213C>T ARSE(NM_001282628.1):c.1246G>A (p.G416R) - ARSE_000036 VKGL data sharing initiative Nederland submitted 2009 - - Germline, CLASSIFICATION record - - - - - Gene Dx, VKGL-NL
?/. 1 - c.1189G>A VUS r.(?) p.(Gly397Arg) g.2856236C>T - ARSE(NM_001282628.1):c.1264G>A (p.G422R) - ARSE_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 2 9 c.1226C>T - r.(?) p.(T409M) g.2856199G>A g.2938158G>A - - ARSE_000011 - PubMed: Nino 2008 - - Germline - - - - - Claudia Matos-Miranda
+?/. 1 - c.1258C>T likely pathogenic r.(?) p.(Arg420Trp) g.2856167G>A - ARSE(NM_000047.2):c.1258C>T (p.(Arg420Trp)) - ARSE_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/., -/. 4 9 c.1270G>A benign r.(?) p.(G424S), p.(Gly424Ser) g.2856155C>T g.2938114C>T ARSE(NM_000047.2):c.1270G>A (p.G424S) - ARSE_000038 VKGL data sharing initiative Nederland - - rs35143646 Germline, CLASSIFICATION record - 0.06-0.83 - - - Claudia Matos-Miranda, Yu Sun, VKGL-NL
+/. 1 9i_10i c.1290-?_1411+?del - r.(?) p.(del) g.2854783_2854904del g.2936742_2936863del - - ARSE_000016 deletion exon 10 PubMed: Brunetti-Pierri 2003 - - Germline - - - - - Claudia Matos-Miranda
-?/. 1 - c.1295T>C likely benign r.(?) p.(Ile432Thr) g.2854899A>G - ARSE(NM_000047.2):c.1295T>C (p.(Ile432Thr)) - ARSE_000065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 3 10 c.1300G>A - r.(?) p.(G434S) g.2854894C>T g.2936853C>T - - ARSE_000010 - submitted 2009 - - Germline - - - - - Gene Dx
-?/. 1 - c.1328G>A likely benign r.(?) p.(Gly443Glu) g.2854866C>T - ARSE(NM_000047.2):c.1328G>A (p.(Gly443Glu)) - ARSE_000077 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 10 c.1387G>A - r.(?) p.(A463T) g.2854807C>T g.2936766C>T - - ARSE_000037 - submitted 2009 - - Germline - - - - - Gene Dx
+/., +?/. 5 11 c.1442C>T - r.(?) p.(T481M), p.T481M g.2853201G>A g.2935160G>A - - ARSE_000017 - PubMed: Brunetti-Pierri 2003, PubMed: Garnier 2007, submitted 2009 - - Germline - - - - - Claudia Matos-Miranda, Gene Dx
+/., +?/. 2 11 c.1475G>A - r.(?) p.(C492Y), p.C492Y g.2853168C>T g.2935127C>T - - ARSE_000006 - PubMed: Parenti Am 1997; OMIM:var0006, PubMed: Daniele A 1998 - - Germline - - - - - Claudia Matos-Miranda
-?/. 1 - c.1485A>C likely benign r.(?) p.(Arg495Ser) g.2853158T>G - ARSE(NM_001282628.1):c.1560A>C (p.R520S) - ARSE_000064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 11 c.1618C>T - r.(?) p.(R540*) g.2853025G>A g.2934984G>A - - ARSE_000018 - PubMed: Brunetti-Pierri 2003 - - Germline - - - - - Claudia Matos-Miranda
?/. 1 - c.1649G>A VUS r.(?) p.(Arg550Gln) g.2852994C>T - ARSE(NM_000047.2):c.1649G>A (p.(Arg550Gln)) - ARSE_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/., -/. 4 11 c.1692C>T benign r.(?) p.(=) g.2852951G>A g.2934910G>A ARSE(NM_000047.2):c.1692C>T (p.N564=) - ARSE_000039 VKGL data sharing initiative Nederland - - rs11222 Germline, CLASSIFICATION record - 0.77-0.81 - - - Claudia Matos-Miranda, Yu Sun, VKGL-NL
-?/. 2 - c.1694T>G likely benign r.(?) p.(Ile565Ser) g.2852949A>C - ARSE(NM_000047.2):c.1694T>G (p.(Ile565Ser)) - ARSE_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Leiden
?/. 1 11 c.1728G>A - r.(?) p.(=) g.2852915C>T g.2934874C>T - - ARSE_000040 - - - rs11055 Germline - 0.33-0.68 - - - Claudia Matos-Miranda
?/., +/., +?/. 4 11 c.1732C>T - r.(?) p.(P578S), p.P578S g.2852911G>A g.2934870G>A 2034C>T - ARSE_000019 - PubMed: Brunetti-Pierri 2003; OMIM:var0007, PubMed: Nino 2008, PubMed: Brunetti-Pierri 2003 - rs28935474 Germline - - - - - Claudia Matos-Miranda
+/. 9 11 c.1743G>A - r.(?) p.(W581*) g.2852900C>T g.2934859C>T 2045G>A - ARSE_000009 - PubMed: Sheffield 1998, PubMed: Brunetti-Pierri 2003; OMIM:var0008 - - Germline - - - - - Claudia Matos-Miranda
Legend