All variants in the GNAS gene

Information The variants shown are described using the transcript reference sequence.

643 entries on 7 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2 3 4 5 6 7     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Predict/PolyPhen     

Predict/PolyPhenScore     

Predict/SIFT     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+?/. _1_13_ c.-242436_*2309673del r.0 p.0 - 0.000 - - likely pathogenic g.57224346_59795557del - - - GNAS_000233 - PubMed: Garin et al. 2015 - - Germline yes - - 0 - Guiomar Perez de Nanclares
-?/. - c.-51564C>T r.(?) p.(=) - - - - likely benign g.57415218C>T g.58840163C>T GNAS(NM_016592.3):c.57C>T (p.D19=) - GNAS_000399 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-51553C>T r.(?) p.(=) - - - - likely benign g.57415229C>T g.58840174C>T GNAS(NM_016592.2):c.68C>T (p.(Pro23Leu)) - GNAS_000400 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.-51485G>C r.(?) p.(=) - - - - likely benign g.57415297G>C - GNAS(NM_016592.2):c.136G>C (p.(Ala46Pro)) - GNAS-AS1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.-51483C>A r.(?) p.(=) - - - - likely benign g.57415299C>A - GNAS(NM_016592.3):c.138C>A (p.A46=) - GNAS-AS1_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-51475A>G r.(?) p.(=) - - - - likely benign g.57415307A>G g.58840252A>G GNAS(NM_016592.3):c.146A>G (p.N49S) - GNAS_000456 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-51416C>A r.(?) p.(=) - - - - likely benign g.57415366C>A g.58840311C>A GNAS(NM_016592.2):c.205C>A (p.(His69Asn)) - GNAS_000457 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.-51381del r.(?) p.(=) - - - - VUS g.57415401del - GNAS(NM_016592.5):c.240delC (p.E81Nfs*21) - GNAS-AS1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. - c.-51327C>T r.(?) p.(=) - - - - benign g.57415455C>T g.58840400C>T GNAS(NM_016592.2):c.294C>T (p.(=)), GNAS(NM_016592.4):c.294C>T (p.P98=) - GNAS_000401 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-51327C>T r.(?) p.(=) - - - - likely benign g.57415455C>T g.58840400C>T GNAS(NM_016592.2):c.294C>T (p.(=)), GNAS(NM_016592.4):c.294C>T (p.P98=) - GNAS_000401 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.-51291_-51268dup r.(?) p.(=) - - - - VUS g.57415491_57415514dup - GNAS(NM_016592.4):c.330_353dupGACCGAGAGCGAGACCGAGTCCGA (p.T111_E118dup) - GNAS-AS1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-51234_-51211del r.(?) p.(=) - - - - likely benign g.57415548_57415571del g.58840493_58840516del GNAS(NM_016592.2):c.382_405del (p.(Pro129_Glu136del)) - GNAS_000402 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. - c.-51225C>A r.(?) p.(=) - - - - benign g.57415557C>A - GNAS(NM_016592.4):c.396C>A (p.A132=) - GNAS-AS1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-51223C>T r.(?) p.(=) - - - - likely benign g.57415559C>T g.58840504C>T GNAS(NM_016592.3):c.398C>T (p.P133L), GNAS(NM_016592.4):c.398C>T (p.P133L) - GNAS-AS1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.-51223C>T r.(?) p.(=) - - - - VUS g.57415559C>T - GNAS(NM_016592.3):c.398C>T (p.P133L), GNAS(NM_016592.4):c.398C>T (p.P133L) - GNAS-AS1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.-51180G>A r.(?) p.(=) - - - - benign g.57415602G>A - GNAS(NM_016592.4):c.441G>A (p.P147=) - GNAS-AS1_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-51107G>A r.(?) p.(=) - - - - likely benign g.57415675G>A - GNAS(NM_016592.4):c.514G>A (p.D172N) - GNAS-AS1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.-51084G>A r.(?) p.(=) - - - - benign g.57415698G>A g.58840643G>A GNAS(NM_016592.3):c.537G>A (p.P179=), GNAS(NM_016592.4):c.537G>A (p.P179=) - GNAS_000458 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-51084G>A r.(?) p.(=) - - - - likely benign g.57415698G>A - GNAS(NM_016592.3):c.537G>A (p.P179=), GNAS(NM_016592.4):c.537G>A (p.P179=) - GNAS_000458 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.-51082C>T r.(?) p.(=) - - - - VUS g.57415700C>T g.58840645C>T GNAS(NM_016592.2):c.539C>T (p.(Pro180Leu)) - GNAS-AS1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.-51060C>A r.(?) p.(=) - - - - likely benign g.57415722C>A g.58840667C>A GNAS(NM_016592.2):c.561C>A (p.(Ser187Arg)) - GNAS_000404 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.-51045G>A r.(?) p.(=) - - - - likely benign g.57415737G>A g.58840682G>A GNAS(NM_016592.3):c.576G>A (p.E192=) - GNAS_000459 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-51029G>A r.(?) p.(=) - - - - likely benign g.57415753G>A g.58840698G>A GNAS(NM_016592.2):c.592G>A (p.(Asp198Asn)) - GNAS_000405 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.-51013A>T r.(?) p.(=) - - - - VUS g.57415769A>T - GNAS(NM_016592.4):c.608A>T (p.D203V) - GNAS-AS1_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.-50984_-50982del r.(?) p.(=) - - - - VUS g.57415798_57415800del g.58840743_58840745del GNAS(NM_016592.2):c.632_634del (p.(Glu213del)) - GNAS-AS1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.-50982G>A r.(?) p.(=) - - - - likely benign g.57415800G>A g.58840745G>A GNAS(NM_016592.3):c.639G>A (p.E213=) - GNAS_000406 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.-50970T>A r.(?) p.(=) - - - - benign g.57415812T>A g.58840757T>A GNAS(NM_016592.4):c.651T>A (p.R217=) - GNAS_000407 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.-50906C>A r.(?) p.(=) - - - - benign g.57415876C>A g.58840821C>A GNAS(NM_016592.2):c.715C>A (p.(Pro239Thr)), GNAS(NM_016592.4):c.715C>A (p.P239T) - GNAS_000408 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. - c.-50906C>A r.(?) p.(=) - - - - benign g.57415876C>A g.58840821C>A GNAS(NM_016592.2):c.715C>A (p.(Pro239Thr)), GNAS(NM_016592.4):c.715C>A (p.P239T) - GNAS_000408 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-50901C>A r.(?) p.(=) - - - - likely benign g.57415881C>A - GNAS(NM_016592.3):c.720C>A (p.I240=) - GNAS-AS1_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. _1 c.-50129_-50089del r.(=) p.(=) - - - - likely pathogenic g.57416653_57416693del g.58841598_58841638del - - GNAS_000174 variant in first intron NESP55 - - - Germline yes - - 0 - Deborah JG Mackay
+?/. _1 c.-50129_-50089del r.(=) p.(=) - - - - likely pathogenic g.57416653_57416693del g.58841598_58841638del - - GNAS_000174 variant in intron 1 NESP55 - - - Germline yes - - 0 - Deborah JG Mackay
?/. _1 c.-48526_-48492del r.(=) p.(=) - - - - VUS g.57418256_57418290del g.58843201_58843235del - - GNAS_000176 deletion intron 1 NESP55; no coding variants of GNAS exons 2-13 - - - Germline yes - - 0 hypomethylation of GNAS-AS, XLAS, GNASA/B; hypermethylation NESP55 DMRs Deborah JG Mackay
-?/. - c.-38455G>A r.(?) p.(=) - - - - likely benign g.57428327G>A - GNAS(NM_080425.3):c.7G>A (p.V3M) - GNAS_000496 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-38451G>A r.(?) p.(=) - - - - likely benign g.57428331G>A g.58853276G>A GNAS(NM_001077490.1):c.-177G>A (p.(=)) - GNAS_000409 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.-38379A>G r.(?) p.(=) - - - - likely benign g.57428403A>G g.58853348A>G GNAS(NM_001077490.1):c.-105A>G (p.(=)) - GNAS_000460 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.-38308G>A r.(?) p.(=) - - - - VUS g.57428474G>A g.58853419G>A GNAS(NM_001077490.1):c.-34G>A (p.(=)), GNAS(NM_080425.3):c.154G>A (p.E52K) - GNAS_000350 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.-38308G>A r.(?) p.(=) - - - - VUS g.57428474G>A - GNAS(NM_001077490.1):c.-34G>A (p.(=)), GNAS(NM_080425.3):c.154G>A (p.E52K) - GNAS_000350 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-38304C>G r.(?) p.(=) - - - - likely benign g.57428478C>G g.58853423C>G GNAS(NM_080425.3):c.158C>G (p.P53R) - GNAS_000410 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-38266G>A r.(?) p.(=) - - - - likely benign g.57428516G>A - GNAS(NM_080425.3):c.196G>A (p.E66K) - GNAS_000482 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-38266G>A r.(?) p.(=) - - - - likely benign g.57428516G>A - GNAS(NM_080425.3):c.196G>A (p.E66K) - GNAS_000482 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.-38002T>C r.(?) p.(=) - - - - VUS g.57428780T>C - GNAS(NM_080425.3):c.460T>C (p.Y154H) - GNAS_000411 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-37978A>G r.(?) p.(=) - - - - likely benign g.57428804A>G g.58853749A>G GNAS(NM_001077490.1):c.297A>G (p.(=)), GNAS(NM_080425.3):c.484A>G (p.M162V), GNAS(NM_080425.4):c.484A>G (p.M162V) - GNAS_000351 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.-37978A>G r.(?) p.(=) - - - - likely benign g.57428804A>G g.58853749A>G GNAS(NM_001077490.1):c.297A>G (p.(=)), GNAS(NM_080425.3):c.484A>G (p.M162V), GNAS(NM_080425.4):c.484A>G (p.M162V) - GNAS_000351 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.-37978A>G r.(?) p.(=) - - - - likely benign g.57428804A>G g.58853749A>G GNAS(NM_001077490.1):c.297A>G (p.(=)), GNAS(NM_080425.3):c.484A>G (p.M162V), GNAS(NM_080425.4):c.484A>G (p.M162V) - GNAS_000351 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-37978A>G r.(?) p.(=) - - - - likely benign g.57428804A>G g.58853749A>G GNAS(NM_001077490.1):c.297A>G (p.(=)), GNAS(NM_080425.3):c.484A>G (p.M162V), GNAS(NM_080425.4):c.484A>G (p.M162V) - GNAS_000351 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.-37962A>G r.(?) p.(=) - - - - likely benign g.57428820A>G g.58853765A>G GNAS(NM_001077490.1):c.313A>G (p.(Thr105Ala)), GNAS(NM_001077490.2):c.313A>G (p.T105A) - GNAS_000352 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-/. - c.-37962A>G r.(?) p.(=) - - - - benign g.57428820A>G g.58853765A>G GNAS(NM_001077490.1):c.313A>G (p.(Thr105Ala)), GNAS(NM_001077490.2):c.313A>G (p.T105A) - GNAS_000352 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-37937T>C r.(?) p.(=) - - - - likely benign g.57428845T>C g.58853790T>C GNAS(NM_001077490.1):c.338T>C (p.(Val113Ala)), GNAS(NM_001077490.2):c.338T>C (p.V113A) - GNAS_000353 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-/. - c.-37937T>C r.(?) p.(=) - - - - benign g.57428845T>C - GNAS(NM_001077490.1):c.338T>C (p.(Val113Ala)), GNAS(NM_001077490.2):c.338T>C (p.V113A) - GNAS_000353 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.-37924C>T r.(?) p.(=) - - - - VUS g.57428858C>T g.58853803C>T GNAS(NM_080425.3):c.538C>T (p.Q180*) - GNAS_000412 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.-37924C>T r.(?) p.(=) - - - - VUS g.57428858C>T g.58853803C>T GNAS(NM_080425.3):c.538C>T (p.Q180*) - GNAS_000412 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.-37924C>T r.(?) p.(=) - - - - VUS g.57428858C>T - GNAS(NM_080425.3):c.538C>T (p.Q180*) - GNAS_000412 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.-37884G>A r.(?) p.(=) - - - - VUS g.57428898G>A g.58853843G>A GNAS(NM_001077490.2):c.391G>A (p.G131R) - GNAS_000413 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.-37835G>A r.(?) p.(=) - - - - benign g.57428947G>A g.58853892G>A GNAS(NM_001077490.1):c.440G>A (p.(Arg147Lys)), GNAS(NM_001077490.2):c.440G>A (p.R147K) - GNAS_000354 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-?/. - c.-37835G>A r.(?) p.(=) - - - - likely benign g.57428947G>A g.58853892G>A GNAS(NM_001077490.1):c.440G>A (p.(Arg147Lys)), GNAS(NM_001077490.2):c.440G>A (p.R147K) - GNAS_000354 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.-37835G>A r.(?) p.(=) - - - - likely benign g.57428947G>A g.58853892G>A GNAS(NM_001077490.1):c.440G>A (p.(Arg147Lys)), GNAS(NM_001077490.2):c.440G>A (p.R147K) - GNAS_000354 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-37834G>C r.(?) p.(=) - - - - likely benign g.57428948G>C g.58853893G>C GNAS(NM_001077490.2):c.441G>C (p.R147S) - GNAS_000355 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.-37834G>C r.(?) p.(=) - - - - likely benign g.57428948G>C - GNAS(NM_001077490.2):c.441G>C (p.R147S) - GNAS_000355 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.-37785T>C r.(?) p.(=) - - - - VUS g.57428997T>C - GNAS(NM_080425.3):c.677T>C (p.F226S) - GNAS_000491 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.-37784T>G r.(?) p.(=) - - - - VUS g.57428998T>G g.58853943T>G GNAS(NM_001077490.2):c.491T>G (p.L164W) - GNAS_000356 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.-37742G>A r.(?) p.(=) - - - - VUS g.57429040G>A g.58853985G>A GNAS(NM_001077490.3):c.533G>A (p.R178Q) - GNAS_000357 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
+/. - c.-37732C>T r.(?) p.(=) - - - - pathogenic g.57429050C>T - GNAS(NM_080425.3):c.730C>T (p.R244*) - GNAS_000516 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.-37715C>A r.(?) p.(=) - - - - pathogenic g.57429067C>A g.58854012C>A GNAS(NM_001077490.2):c.560C>A (p.S187*) - GNAS_000461 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.-37695C>T r.(?) p.(=) - - - - VUS g.57429087C>T - GNAS(NM_001077490.2):c.580C>T (p.R194W) - GNAS_000483 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-37688C>T r.(?) p.(=) - - - - likely benign g.57429094C>T g.58854039C>T GNAS(NM_001077490.1):c.587C>T (p.(Ser196Leu)) - GNAS_000414 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.-37684G>T r.(?) p.(=) - - - - likely benign g.57429098G>T - GNAS(NM_080425.3):c.778G>T (p.A260S) - GNAS_000497 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.-37666C>T r.(?) p.(=) - - - - VUS g.57429116C>T - GNAS(NM_080425.2):c.796C>T (p.(Leu266Phe)) - GNAS_000498 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. - c.-37653C>T r.(?) p.(=) - - - - pathogenic g.57429129C>T - - - GNAS_000484 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.-37641C>T r.(?) p.(=) - - - - VUS g.57429141C>T g.58854086C>T GNAS(NM_001077490.2):c.634C>T (p.P212S) - GNAS_000415 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-37574G>A r.(?) p.(=) - - - - likely benign g.57429208G>A g.58854153G>A GNAS(NM_001077490.2):c.701G>A (p.R234Q) - GNAS_000416 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-37565C>A r.(?) p.(=) - - - - likely benign g.57429217C>A g.58854162C>A GNAS(NM_001077490.2):c.710C>A (p.A237D) - GNAS_000359 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.-37565C>A r.(?) p.(=) - - - - likely benign g.57429217C>A - GNAS(NM_001077490.2):c.710C>A (p.A237D) - GNAS_000359 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-37549T>C r.(?) p.(=) - - - - likely benign g.57429233T>C g.58854178T>C GNAS(NM_080425.3):c.913T>C (p.S305P) - GNAS_000462 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-37523C>G r.(?) p.(=) - - - - likely benign g.57429259C>G g.58854204C>G GNAS(NM_001077490.1):c.752C>G (p.(Ala251Gly)) - GNAS_000417 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.-37504_-37502del r.(?) p.(=) - - - - VUS g.57429278_57429280del g.58854223_58854225del GNAS(NM_001077490.2):c.771_773delGAC (p.T258del), GNAS(NM_001077490.3):c.771_773delGAC (p.T258del) - GNAS_000463 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.-37504_-37502del r.(?) p.(=) - - - - VUS g.57429278_57429280del - GNAS(NM_001077490.2):c.771_773delGAC (p.T258del), GNAS(NM_001077490.3):c.771_773delGAC (p.T258del) - GNAS_000463 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.-37472C>T r.(?) p.(=) - - - - likely benign g.57429310C>T g.58854255C>T GNAS(NM_001077490.2):c.803C>T (p.S268L) - GNAS_000361 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.-37461G>A r.(?) p.(=) - - - - likely benign g.57429321G>A - GNAS(NM_001077490.2):c.814G>A (p.A272T) - GNAS_000418 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-37442C>T r.(?) p.(=) - - - - likely benign g.57429340C>T - GNAS(NM_001077490.2):c.833C>T (p.P278L) - GNAS_000517 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.-37437C>A r.(?) p.(=) - - - - VUS g.57429345C>A g.58854290C>A GNAS(NM_001077490.2):c.838C>A (p.P280T) - GNAS_000362 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.-37398A>G r.(?) p.(=) - - - - likely benign g.57429384A>G - GNAS(NM_001077490.2):c.877A>G (p.R293G) - GNAS_000518 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.-37358G>A r.(?) p.(=) - - - - VUS g.57429424G>A g.58854369G>A GNAS(NM_001077490.1):c.917G>A (p.(Arg306Gln)) - GNAS_000363 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-/. - c.-37335C>T r.(?) p.(=) - - - - benign g.57429447C>T g.58854392C>T GNAS(NM_001077490.1):c.940C>T (p.(Arg314Trp)), GNAS(NM_001077490.2):c.940C>T (p.R314W) - GNAS_000419 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-37335C>T r.(?) p.(=) - - - - likely benign g.57429447C>T g.58854392C>T GNAS(NM_001077490.1):c.940C>T (p.(Arg314Trp)), GNAS(NM_001077490.2):c.940C>T (p.R314W) - GNAS_000419 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. - c.-37335C>T r.(?) p.(=) - - - - benign g.57429447C>T g.58854392C>T GNAS(NM_001077490.1):c.940C>T (p.(Arg314Trp)), GNAS(NM_001077490.2):c.940C>T (p.R314W) - GNAS_000419 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.-37333G>C r.(?) p.(=) - - - - likely benign g.57429449G>C g.58854394G>C GNAS(NM_001077490.1):c.942G>C (p.(=)) - GNAS_000420 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.-37295T>A r.(?) p.(=) - - - - likely benign g.57429487T>A g.58854432T>A GNAS(NM_001077490.1):c.980T>A (p.(Ile327Lys)) - GNAS_000364 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.-37274_-37266dup r.(?) p.(=) - - - - likely benign g.57429508_57429516dup g.58854453_58854461dup GNAS(NM_001077490.1):c.992_993insGCAGCCCCT (p.(Gly331_Gln332insGlnProLeu)), GNAS(NM_001077490.2):c.1001_1009dupTGCAGCCCC (p.L334_P336dup) - GNAS_000366 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-/. - c.-37274_-37266dup r.(?) p.(=) - - - - benign g.57429508_57429516dup g.58854453_58854461dup GNAS(NM_001077490.1):c.992_993insGCAGCCCCT (p.(Gly331_Gln332insGlnProLeu)), GNAS(NM_001077490.2):c.1001_1009dupTGCAGCCCC (p.L334_P336dup) - GNAS_000366 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.-37274_-37266dup r.(?) p.(=) - - - - benign g.57429508_57429516dup g.58854453_58854461dup GNAS(NM_001077490.1):c.992_993insGCAGCCCCT (p.(Gly331_Gln332insGlnProLeu)), GNAS(NM_001077490.2):c.1001_1009dupTGCAGCCCC (p.L334_P336dup) - GNAS_000366 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-37261G>A r.(?) p.(=) - - - - likely benign g.57429521G>A g.58854466G>A GNAS(NM_001077490.1):c.1014G>A (p.(=)) - GNAS_000422 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.-37241C>G r.(?) p.(=) - - - - likely benign g.57429541C>G g.58854486C>G GNAS(NM_001077490.1):c.1034C>G (p.(Pro345Arg)), GNAS(NM_001077490.2):c.1034C>G (p.P345R) - GNAS_000367 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.-37241C>G r.(?) p.(=) - - - - VUS g.57429541C>G g.58854486C>G GNAS(NM_001077490.1):c.1034C>G (p.(Pro345Arg)), GNAS(NM_001077490.2):c.1034C>G (p.P345R) - GNAS_000367 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.-37241C>G r.(?) p.(=) - - - - likely benign g.57429541C>G - GNAS(NM_001077490.1):c.1034C>G (p.(Pro345Arg)), GNAS(NM_001077490.2):c.1034C>G (p.P345R) - GNAS_000367 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.-37229_-37203del r.(?) p.(=) - - - - benign g.57429553_57429579del g.58854498_58854524del GNAS(NM_001077490.1):c.1041_1067del (p.(Pro349_Ile357del)), GNAS(NM_001077490.2):c.1046_1072delCGACTCCGGGACAGCACCAGCCGATCC (p.P349_I357del) - GNAS_000368 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.-37229_-37203del r.(?) p.(=) - - - - VUS g.57429553_57429579del g.58854498_58854524del GNAS(NM_001077490.1):c.1041_1067del (p.(Pro349_Ile357del)), GNAS(NM_001077490.2):c.1046_1072delCGACTCCGGGACAGCACCAGCCGATCC (p.P349_I357del) - GNAS_000368 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.-37222G>A r.(?) p.(=) - - - - likely benign g.57429560G>A g.58854505G>A GNAS(NM_080425.3):c.1240G>A (p.G414R) - GNAS_000464 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-37195G>C r.(?) p.(=) - - - - likely benign g.57429587G>C - GNAS(NM_080425.3):c.1267G>C (p.G423R) - GNAS_000519 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-37192G>C r.(?) p.(=) - - - - likely benign g.57429590G>C - GNAS(NM_080425.3):c.1270G>C (p.A424P) - GNAS_000499 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query   « First ‹ Prev     1 2 3 4 5 6 7     Next › Last »