Unique variants in the GNAS gene

Information The variants shown are described using the transcript reference sequence.

272 entries on 3 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2 3     Next › Last »

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Predict/PolyPhen     

Predict/PolyPhenScore     

Predict/SIFT     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. 1 - c.-51564C>T r.(?) p.(=) - - - - likely benign g.57415218C>T g.58840163C>T GNAS(NM_016592.3):c.57C>T (p.D19=) - GNAS_000399 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-51553C>T r.(?) p.(=) - - - - likely benign g.57415229C>T g.58840174C>T GNAS(NM_016592.2):c.68C>T (p.(Pro23Leu)) - GNAS_000400 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-51493G>A r.(?) p.(=) - - - - VUS g.57415289G>A - GNAS(NM_016592.3):c.128G>A (p.R43H) - GNAS-AS1_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-51485G>C r.(?) p.(=) - - - - likely benign g.57415297G>C - GNAS(NM_000516.4):c.-51485G>C (p.(=)) - GNAS-AS1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-51483C>A r.(?) p.(=) - - - - likely benign g.57415299C>A - GNAS(NM_016592.3):c.138C>A (p.A46=) - GNAS-AS1_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-51475A>G r.(?) p.(=) - - - - likely benign g.57415307A>G g.58840252A>G GNAS(NM_016592.3):c.146A>G (p.N49S) - GNAS_000456 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-51416C>A r.(?) p.(=) - - - - likely benign g.57415366C>A g.58840311C>A GNAS(NM_016592.2):c.205C>A (p.(His69Asn)) - GNAS_000457 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-51381del r.(?) p.(=) - - - - VUS g.57415401del - GNAS(NM_016592.5):c.240delC (p.E81Nfs*21) - GNAS-AS1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/., -?/. 2 - c.-51327C>T r.(?) p.(=) - - - - benign, likely benign g.57415455C>T g.58840400C>T GNAS(NM_000516.4):c.-51327C>T (p.(=)), GNAS(NM_016592.5):c.294C>T (p.P98=) - GNAS_000401 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_AMC
?/. 1 - c.-51291_-51268dup r.(?) p.(=) - - - - VUS g.57415491_57415514dup - GNAS(NM_016592.5):c.330_353dupGACCGAGAGCGAGACCGAGTCCGA (p.T111_E118dup) - GNAS-AS1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.-51246C>G r.(?) p.(=) - - - - likely benign g.57415536C>G - GNAS(NM_016592.3):c.375C>G (p.F125L) - GNAS-AS1_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-51234_-51211del r.(?) p.(=) - - - - likely benign g.57415548_57415571del g.58840493_58840516del GNAS(NM_016592.2):c.382_405del (p.(Ala132_Thr139del)) - GNAS_000402 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.-51225C>A r.(?) p.(=) - - - - benign g.57415557C>A - GNAS(NM_016592.5):c.396C>A (p.A132=) - GNAS-AS1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/., ?/. 2 - c.-51223C>T r.(?) p.(=) - - - - likely benign, VUS g.57415559C>T g.58840504C>T GNAS(NM_016592.3):c.398C>T (p.P133L), GNAS(NM_016592.5):c.398C>T (p.P133L) - GNAS-AS1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
-/., -?/. 2 - c.-51180G>A r.(?) p.(=) - - - - benign, likely benign g.57415602G>A - GNAS(NM_016592.3):c.441G>A (p.P147=), GNAS(NM_016592.5):c.441G>A (p.P147=) - GNAS-AS1_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
?/. 1 - c.-51137C>A r.(?) p.(=) - - - - VUS g.57415645C>A - GNAS(NM_016592.3):c.484C>A (p.R162S) - GNAS-AS1_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - c.-51107G>A r.(?) p.(=) - - - - likely benign g.57415675G>A - GNAS(NM_016592.3):c.514G>A (p.D172N), GNAS(NM_016592.5):c.514G>A (p.D172N) - GNAS-AS1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.-51090C>A r.(?) p.(=) - - - - likely benign g.57415692C>A - GNAS(NM_016592.5):c.531C>A (p.R177=) - GNAS-AS1_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/., -?/. 2 - c.-51084G>A r.(?) p.(=) - - - - benign, likely benign g.57415698G>A g.58840643G>A GNAS(NM_016592.3):c.537G>A (p.P179=), GNAS(NM_016592.5):c.537G>A (p.P179=) - GNAS_000458 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
?/. 1 - c.-51082C>T r.(?) p.(=) - - - - VUS g.57415700C>T g.58840645C>T GNAS(NM_016592.2):c.539C>T (p.(Pro180Leu)) - GNAS-AS1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-51060C>A r.(?) p.(=) - - - - likely benign g.57415722C>A g.58840667C>A GNAS(NM_016592.2):c.561C>A (p.(Ser187Arg)) - GNAS_000404 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-51045G>A r.(?) p.(=) - - - - likely benign g.57415737G>A g.58840682G>A GNAS(NM_016592.3):c.576G>A (p.E192=) - GNAS_000459 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-51029G>A r.(?) p.(=) - - - - likely benign g.57415753G>A g.58840698G>A GNAS(NM_016592.2):c.592G>A (p.(Asp198Asn)) - GNAS_000405 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-51013A>T r.(?) p.(=) - - - - VUS g.57415769A>T - GNAS(NM_016592.5):c.608A>T (p.D203V) - GNAS-AS1_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.-50984_-50982del r.(?) p.(=) - - - - VUS g.57415798_57415800del g.58840743_58840745del GNAS(NM_016592.2):c.632_634del (p.(Glu213del)) - GNAS-AS1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-50982G>A r.(?) p.(=) - - - - likely benign g.57415800G>A g.58840745G>A GNAS(NM_016592.3):c.639G>A (p.E213=) - GNAS_000406 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.-50970T>A r.(?) p.(=) - - - - benign g.57415812T>A g.58840757T>A GNAS(NM_016592.5):c.651T>A (p.R217=) - GNAS_000407 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 2 - c.-50906C>A r.(?) p.(=) - - - - benign g.57415876C>A g.58840821C>A GNAS(NM_000516.4):c.-50906C>A (p.(=)), GNAS(NM_016592.5):c.715C>A (p.P239T) - GNAS_000408 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_AMC
-?/. 1 - c.-50901C>A r.(?) p.(=) - - - - likely benign g.57415881C>A - GNAS(NM_016592.3):c.720C>A (p.I240=) - GNAS-AS1_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-38455G>A r.(?) p.(=) - - - - likely benign g.57428327G>A - GNAS(NM_080425.3):c.7G>A (p.V3M) - GNAS_000496 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-38451G>A r.(?) p.(=) - - - - likely benign g.57428331G>A g.58853276G>A GNAS(NM_001077490.1):c.-177G>A (p.(=)) - GNAS_000409 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-38379A>G r.(?) p.(=) - - - - likely benign g.57428403A>G g.58853348A>G GNAS(NM_001077490.1):c.-105A>G (p.(=)) - GNAS_000460 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 3 - c.-38308G>A r.(?) p.(=) - - - - VUS g.57428474G>A g.58853419G>A 1 more item - GNAS_000350 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.-38304C>G r.(?) p.(=) - - - - likely benign g.57428478C>G g.58853423C>G GNAS(NM_080425.3):c.158C>G (p.P53R) - GNAS_000410 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 3 - c.-38266G>A r.(?) p.(=) - - - - likely benign g.57428516G>A - 1 more item - GNAS_000482 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/., ?/. 2 - c.-38002T>C r.(?) p.(=) - - - - likely benign, VUS g.57428780T>C - GNAS(NM_080425.3):c.460T>C (p.Y154H), GNAS(NM_080425.4):c.460T>C (p.Y154H) - GNAS_000411 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 4 - c.-37978A>G r.(?) p.(=) - - - - likely benign g.57428804A>G g.58853749A>G 1 more item - GNAS_000351 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_AMC
-/., -?/. 2 - c.-37962A>G r.(?) p.(=) - - - - benign, likely benign g.57428820A>G g.58853765A>G GNAS(NM_001077490.1):c.313A>G (p.(Thr105Ala)), GNAS(NM_001077490.3):c.313A>G (p.T105A) - GNAS_000352 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_AMC
-/., -?/. 2 - c.-37937T>C r.(?) p.(=) - - - - benign, likely benign g.57428845T>C g.58853790T>C GNAS(NM_000516.4):c.-37937T>C (p.(=)), GNAS(NM_001077490.3):c.338T>C (p.V113A) - GNAS_000353 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_AMC
?/. 3 - c.-37924C>T r.(?) p.(=) - - - - VUS g.57428858C>T g.58853803C>T GNAS(NM_080425.3):c.538C>T (p.Q180*), GNAS(NM_080425.4):c.538C>T (p.Q180*) - GNAS_000412 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Nijmegen, VKGL-NL_AMC
?/. 1 - c.-37884G>A r.(?) p.(=) - - - - VUS g.57428898G>A g.58853843G>A GNAS(NM_001077490.2):c.391G>A (p.G131R) - GNAS_000413 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/., -?/. 3 - c.-37835G>A r.(?) p.(=) - - - - benign, likely benign g.57428947G>A g.58853892G>A 1 more item - GNAS_000354 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Utrecht, VKGL-NL_AMC
-?/. 2 - c.-37834G>C r.(?) p.(=) - - - - likely benign g.57428948G>C g.58853893G>C GNAS(NM_001077490.2):c.441G>C (p.R147S), GNAS(NM_001077490.3):c.441G>C (p.R147S) - GNAS_000355 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.-37834G>T r.(?) p.(=) - - - - likely benign g.57428948G>T - GNAS(NM_001077490.2):c.441G>T (p.R147S) - GNAS_000532 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-37801G>A r.(?) p.(=) - - - - likely benign g.57428981G>A - GNAS(NM_080425.3):c.661G>A (p.E221K) - GNAS_000533 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-37784T>G r.(?) p.(=) - - - - VUS g.57428998T>G g.58853943T>G GNAS(NM_001077490.2):c.491T>G (p.L164W) - GNAS_000356 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-37742G>A r.(?) p.(=) - - - - VUS g.57429040G>A g.58853985G>A GNAS(NM_001077490.3):c.533G>A (p.R178Q) - GNAS_000357 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 1 - c.-37732C>T r.(?) p.(=) - - - - pathogenic g.57429050C>T - GNAS(NM_080425.3):c.730C>T (p.R244*) - GNAS_000516 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.-37715C>A r.(?) p.(=) - - - - pathogenic g.57429067C>A g.58854012C>A GNAS(NM_001077490.2):c.560C>A (p.S187*) - GNAS_000461 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-37695C>T r.(?) p.(=) - - - - VUS g.57429087C>T - GNAS(NM_001077490.2):c.580C>T (p.R194W) - GNAS_000483 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-37688C>T r.(?) p.(=) - - - - likely benign g.57429094C>T g.58854039C>T GNAS(NM_001077490.1):c.587C>T (p.(Ser196Leu)) - GNAS_000414 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-37684G>T r.(?) p.(=) - - - - likely benign g.57429098G>T - GNAS(NM_080425.4):c.778G>T (p.A260S) - GNAS_000497 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.-37666C>T r.(?) p.(=) - - - - VUS g.57429116C>T - GNAS(NM_000516.4):c.-37666C>T (p.(=)) - GNAS_000498 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-37646G>A r.(?) p.(=) - - - - likely benign g.57429136G>A - GNAS(NM_000516.4):c.-37646G>A (p.(=)) - GNAS_000534 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 2 - c.-37641C>T r.(?) p.(=) - - - - VUS g.57429141C>T g.58854086C>T GNAS(NM_000516.4):c.-37641C>T (p.(=)), GNAS(NM_001077490.2):c.634C>T (p.P212S) - GNAS_000415 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
-?/. 1 - c.-37574G>A r.(?) p.(=) - - - - likely benign g.57429208G>A g.58854153G>A GNAS(NM_001077490.2):c.701G>A (p.R234Q) - GNAS_000416 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - c.-37565C>A r.(?) p.(=) - - - - likely benign g.57429217C>A g.58854162C>A GNAS(NM_001077490.2):c.710C>A (p.A237D), GNAS(NM_001077490.3):c.710C>A (p.A237D) - GNAS_000359 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/., ?/. 2 - c.-37549T>C r.(?) p.(=) - - - - likely benign, VUS g.57429233T>C g.58854178T>C GNAS(NM_080425.3):c.913T>C (p.S305P), GNAS(NM_080425.4):c.913T>C (p.S305P) - GNAS_000462 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.-37523C>G r.(?) p.(=) - - - - likely benign g.57429259C>G g.58854204C>G GNAS(NM_001077490.1):c.752C>G (p.(Ala251Gly)) - GNAS_000417 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 2 - c.-37504_-37502del r.(?) p.(=) - - - - VUS g.57429278_57429280del g.58854223_58854225del GNAS(NM_001077490.2):c.771_773delGAC (p.T258del), GNAS(NM_001077490.3):c.771_773delGAC (p.T258del) - GNAS_000463 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
-?/. 1 - c.-37476C>G r.(?) p.(=) - - - - likely benign g.57429306C>G - GNAS(NM_001077490.3):c.799C>G (p.Q267E) - GNAS_000535 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.-37472C>A r.(?) p.(=) - - - - VUS g.57429310C>A - - - GNAS_000544 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.-37472C>T r.(?) p.(=) - - - - likely benign g.57429310C>T g.58854255C>T GNAS(NM_001077490.2):c.803C>T (p.S268L) - GNAS_000361 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - c.-37461G>A r.(?) p.(=) - - - - likely benign g.57429321G>A - GNAS(NM_001077490.2):c.814G>A (p.A272T), GNAS(NM_001077490.3):c.814G>A (p.A272T) - GNAS_000418 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.-37442C>T r.(?) p.(=) - - - - likely benign g.57429340C>T - GNAS(NM_001077490.2):c.833C>T (p.P278L) - GNAS_000517 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-37437C>A r.(?) p.(=) - - - - VUS g.57429345C>A g.58854290C>A GNAS(NM_001077490.2):c.838C>A (p.P280T) - GNAS_000362 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-37398A>G r.(?) p.(=) - - - - likely benign g.57429384A>G - GNAS(NM_001077490.2):c.877A>G (p.R293G) - GNAS_000518 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-37358G>A r.(?) p.(=) - - - - VUS g.57429424G>A g.58854369G>A GNAS(NM_001077490.1):c.917G>A (p.(Arg306Gln)) - GNAS_000363 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/., -?/. 3 - c.-37335C>T r.(?) p.(=) - - - - benign, likely benign g.57429447C>T g.58854392C>T 1 more item - GNAS_000419 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Utrecht, VKGL-NL_AMC
-?/. 1 - c.-37333G>C r.(?) p.(=) - - - - likely benign g.57429449G>C g.58854394G>C GNAS(NM_001077490.1):c.942G>C (p.(=)) - GNAS_000420 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-37298G>A r.(?) p.(=) - - - - likely benign g.57429484G>A - GNAS(NM_001077490.3):c.977G>A (p.R326Q) - GNAS_000536 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.-37295T>A r.(?) p.(=) - - - - likely benign g.57429487T>A g.58854432T>A GNAS(NM_001077490.1):c.980T>A (p.(Ile327Lys)) - GNAS_000364 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/., -?/. 3 - c.-37274_-37266dup r.(?) p.(=) - - - - benign, likely benign g.57429508_57429516dup g.58854453_58854461dup 1 more item - GNAS_000366 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.-37261G>A r.(?) p.(=) - - - - likely benign g.57429521G>A g.58854466G>A GNAS(NM_001077490.1):c.1014G>A (p.(=)) - GNAS_000422 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/., ?/. 2 - c.-37241C>G r.(?) p.(=) - - - - likely benign, VUS g.57429541C>G g.58854486C>G GNAS(NM_001077490.1):c.1034C>G (p.(Pro345Arg)), GNAS(NM_001077490.2):c.1034C>G (p.P345R) - GNAS_000367 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
-/., ?/. 3 - c.-37229_-37203del r.(?) p.(=) - - - - benign, VUS g.57429553_57429579del g.58854498_58854524del 1 more item - GNAS_000368 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.-37222G>A r.(?) p.(=) - - - - likely benign g.57429560G>A g.58854505G>A GNAS(NM_080425.3):c.1240G>A (p.G414R) - GNAS_000464 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-37195G>C r.(?) p.(=) - - - - likely benign g.57429587G>C - GNAS(NM_080425.3):c.1267G>C (p.G423R) - GNAS_000519 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-37192G>C r.(?) p.(=) - - - - likely benign g.57429590G>C - GNAS(NM_080425.3):c.1270G>C (p.A424P) - GNAS_000499 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/., ?/. 3 - c.-37182C>A r.(?) p.(=) - - - - likely benign, VUS g.57429600C>A g.58854545C>A 1 more item - GNAS_000369 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.-37178T>G r.(?) p.(=) - - - - likely benign g.57429604T>G - GNAS(NM_000516.4):c.-37178T>G (p.(=)) - GNAS_000537 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-37163A>G r.(?) p.(=) - - - - likely benign g.57429619A>G g.58854564A>G GNAS(NM_001077490.1):c.1112A>G (p.(Gln371Arg)) - GNAS_000423 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/., ?/. 2 - c.-37163_-37128del r.(?) p.(=) - - - - likely benign, VUS g.57429619_57429654del g.58854564_58854599del 1 more item - GNAS_000465 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_AMC
-?/. 2 - c.-37155C>A r.(?) p.(=) - - - - likely benign g.57429627C>A g.58854572C>A GNAS(NM_000516.4):c.-37155C>A (p.(=)), GNAS(NM_001077490.3):c.1120C>A (p.P374T) - GNAS_000424 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_AMC
-?/. 1 - c.-37153G>T r.(?) p.(=) - - - - likely benign g.57429629G>T - GNAS(NM_080425.3):c.1309G>T (p.A437S) - GNAS_000500 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-37139C>T r.(?) p.(=) - - - - VUS g.57429643C>T - GNAS(NM_001077490.2):c.1136C>T (p.P379L) - GNAS_000485 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/., ?/. 2 - c.-37132G>A r.(?) p.(=) - - - - likely benign, VUS g.57429650G>A g.58854595G>A GNAS(NM_080425.3):c.1330G>A (p.G444R), GNAS(NM_080425.4):c.1330G>A (p.G444R) - GNAS_000370 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 2 - c.-37127G>A r.(?) p.(=) - - - - likely benign g.57429655G>A g.58854600G>A GNAS(NM_001077490.1):c.1148G>A (p.(Arg383Gln)), GNAS(NM_001077490.2):c.1148G>A (p.R383Q) - GNAS_000426 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
-?/. 2 - c.-37119A>C r.(?) p.(=) - - - - likely benign g.57429663A>C g.58854608A>C GNAS(NM_001077490.1):c.1156A>C (p.(Thr386Pro)), GNAS(NM_001077490.3):c.1156A>C (p.T386P) - GNAS_000427 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_AMC
?/. 1 - c.-37096G>A r.(?) p.(=) - - - - VUS g.57429686G>A g.58854631G>A GNAS(NM_080425.3):c.1366G>A (p.G456R) - GNAS_000371 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-37091G>C r.(?) p.(=) - - - - likely benign g.57429691G>C g.58854636G>C GNAS(NM_001077490.2):c.1184G>C (p.R395P) - GNAS_000478 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/., -?/. 3 - c.-37086C>G r.(?) p.(=) - - - - benign, likely benign g.57429696C>G g.58854641C>G 1 more item - GNAS_000428 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Utrecht, VKGL-NL_AMC
-/., -?/. 3 - c.-37068_-37067insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC r.(?) p.(=) - - - - benign, likely benign g.57429714_57429715insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC g.58854659_58854660insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC 1 more item - GNAS_000373 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Utrecht, VKGL-NL_AMC
?/. 1 - c.-37067A>C r.(?) p.(=) - - - - VUS g.57429715A>C g.58854660A>C GNAS(NM_001077490.1):c.1208A>C (p.(Gln403Pro)) - GNAS_000374 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-37065_-37064insC r.(?) p.(=) - - - - VUS g.57429717_57429718insC g.58854662_58854663insC GNAS(NM_001077490.1):c.1210_1211insC (p.?) - GNAS_000466 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-37064T>C r.(?) p.(=) - - - - VUS g.57429718T>C g.58854663T>C GNAS(NM_001077490.1):c.1211T>C (p.(Met404Thr)) - GNAS_000375 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.-37063G>T r.(?) p.(=) - - - - VUS g.57429719G>T g.58854664G>T GNAS(NM_001077490.1):c.1212G>T (p.(Met404Ile)) - GNAS_000376 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 3 - c.-37034C>G r.(?) p.(=) - - - - likely benign g.57429748C>G g.58854693C>G 1 more item - GNAS_000377 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_AMC
-?/. 1 - c.-37033C>T r.(?) p.(=) - - - - likely benign g.57429749C>T - GNAS(NM_080425.3):c.1429C>T (p.P477S) - GNAS_000501 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-37022T>A r.(?) p.(=) - - - - likely benign g.57429760T>A - GNAS(NM_001077490.3):c.1253T>A (p.L418Q) - GNAS_000502 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
Legend   How to query   « First ‹ Prev     1 2 3     Next › Last »