All transcript variants in gene GNAS

Information The variants shown are described using the transcript reference sequence.

544 entries on 6 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2 3 4 5 6     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     

Predict/PolyPhen     

Predict/PolyPhenScore     

Predict/SIFT     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+?/. _1_13_ c.-242436_*2309673del - r.0 p.0 - - - g. 57224346_59795557del - - - GNAS_000233 - PubMed: Garin et al. 2015 - - Germline yes - - 0 - Guiomar Perez de Nanclares
-?/. - c.-51564C>T likely benign r.(?) p.(=) - - - g.57415218C>T - GNAS(NM_016592.3):c.57C>T (p.D19=) - GNAS_000399 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-51553C>T likely benign r.(?) p.(=) - - - g.57415229C>T - GNAS(NM_016592.2):c.68C>T (p.(Pro23Leu)) - GNAS_000400 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-51475A>G likely benign r.(?) p.(=) - - - g.57415307A>G - GNAS(NM_016592.3):c.146A>G (p.N49S) - GNAS_000456 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-51416C>A likely benign r.(?) p.(=) - - - g.57415366C>A - GNAS(NM_016592.2):c.205C>A (p.(His69Asn)) - GNAS_000457 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. - c.-51327C>T benign r.(?) p.(=) - - - g.57415455C>T - GNAS(NM_016592.4):c.294C>T (p.P98=) - GNAS_000401 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-51234_-51211del likely benign r.(?) p.(=) - - - g.57415548_57415571del - GNAS(NM_016592.2):c.382_405del (p.(Pro129_Glu136del)) - GNAS_000402 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-51223C>T likely benign r.(?) p.(=) - - - g.57415559C>T - GNAS(NM_016592.3):c.398C>T (p.P133L) - GNAS-AS1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. - c.-51084G>A benign r.(?) p.(=) - - - g.57415698G>A - GNAS(NM_016592.4):c.537G>A (p.P179=) - GNAS_000458 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-51082C>T VUS r.(?) p.(=) - - - g.57415700C>T - GNAS(NM_016592.2):c.539C>T (p.(Pro180Leu)) - GNAS-AS1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.-51060C>A likely benign r.(?) p.(=) - - - g.57415722C>A - GNAS(NM_016592.2):c.561C>A (p.(Ser187Arg)) - GNAS_000404 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-51045G>A likely benign r.(?) p.(=) - - - g.57415737G>A - GNAS(NM_016592.3):c.576G>A (p.E192=) - GNAS_000459 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-51029G>A likely benign r.(?) p.(=) - - - g.57415753G>A - GNAS(NM_016592.2):c.592G>A (p.(Asp198Asn)) - GNAS_000405 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-50984_-50982del VUS r.(?) p.(=) - - - g.57415798_57415800del - GNAS(NM_016592.2):c.632_634del (p.(Glu213del)) - GNAS-AS1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.-50982G>A likely benign r.(?) p.(=) - - - g.57415800G>A - GNAS(NM_016592.3):c.639G>A (p.E213=) - GNAS_000406 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. - c.-50970T>A benign r.(?) p.(=) - - - g.57415812T>A - GNAS(NM_016592.4):c.651T>A (p.R217=) - GNAS_000407 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-50906C>A likely benign r.(?) p.(=) - - - g.57415876C>A - GNAS(NM_016592.2):c.715C>A (p.(Pro239Thr)), GNAS(NM_016592.4):c.715C>A (p.P239T) - GNAS_000408 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. - c.-50906C>A benign r.(?) p.(=) - - - g.57415876C>A - GNAS(NM_016592.2):c.715C>A (p.(Pro239Thr)), GNAS(NM_016592.4):c.715C>A (p.P239T) - GNAS_000408 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+?/. _1 c.-50129_-50089del - r.(=) p.(=) - - - g.57416653_57416693del g.58841598_58841638del - - GNAS_000174 variant in first intron NESP55 - - - Germline yes - - 0 - Deborah JG Mackay
+?/. _1 c.-50129_-50089del - r.(=) p.(=) - - - g.57416653_57416693del g.58841598_58841638del - - GNAS_000174 variant in intron 1 NESP55 - - - Germline yes - - 0 - Deborah JG Mackay
?/. _1 c.-48526_-48492del - r.(=) p.(=) - - - g.57418256_57418290del g.58843201_58843235del - - GNAS_000176 deletion intron 1 NESP55; no coding variants of GNAS exons 2-13 - - - Germline yes - - 0 hypomethylation of GNAS-AS, XLAS, GNASA/B; hypermethylation NESP55 DMRs Deborah JG Mackay
-?/. - c.-38451G>A likely benign r.(?) p.(=) - - - g.57428331G>A - GNAS(NM_001077490.1):c.-177G>A (p.(=)) - GNAS_000409 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-38379A>G likely benign r.(?) p.(=) - - - g.57428403A>G - GNAS(NM_001077490.1):c.-105A>G (p.(=)) - GNAS_000460 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-38308G>A VUS r.(?) p.(=) - - - g.57428474G>A - GNAS(NM_001077490.1):c.-34G>A (p.(=)) - GNAS_000350 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.-38304C>G likely benign r.(?) p.(=) - - - g.57428478C>G - GNAS(NM_080425.3):c.158C>G (p.P53R) - GNAS_000410 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-38002T>C VUS r.(?) p.(=) - - - g.57428780T>C - GNAS(NM_080425.3):c.460T>C (p.Y154H) - GNAS_000411 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-37978A>G likely benign r.(?) p.(=) - - - g.57428804A>G - GNAS(NM_001077490.1):c.297A>G (p.(=)), GNAS(NM_080425.3):c.484A>G (p.M162V) - GNAS_000351 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.-37978A>G likely benign r.(?) p.(=) - - - g.57428804A>G - GNAS(NM_001077490.1):c.297A>G (p.(=)), GNAS(NM_080425.3):c.484A>G (p.M162V) - GNAS_000351 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.-37978A>G likely benign r.(?) p.(=) - - - g.57428804A>G - GNAS(NM_001077490.1):c.297A>G (p.(=)), GNAS(NM_080425.3):c.484A>G (p.M162V) - GNAS_000351 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-37978A>G likely benign r.(?) p.(=) - - - g.57428804A>G - GNAS(NM_001077490.1):c.297A>G (p.(=)), GNAS(NM_080425.3):c.484A>G (p.M162V) - GNAS_000351 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.-37962A>G likely benign r.(?) p.(=) - - - g.57428820A>G - GNAS(NM_001077490.1):c.313A>G (p.(Thr105Ala)), GNAS(NM_001077490.2):c.313A>G (p.T105A) - GNAS_000352 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-/. - c.-37962A>G benign r.(?) p.(=) - - - g.57428820A>G - GNAS(NM_001077490.1):c.313A>G (p.(Thr105Ala)), GNAS(NM_001077490.2):c.313A>G (p.T105A) - GNAS_000352 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-37937T>C likely benign r.(?) p.(=) - - - g.57428845T>C - GNAS(NM_001077490.1):c.338T>C (p.(Val113Ala)) - GNAS_000353 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.-37924C>T VUS r.(?) p.(=) - - - g.57428858C>T - GNAS(NM_080425.3):c.538C>T (p.Q180*) - GNAS_000412 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.-37924C>T VUS r.(?) p.(=) - - - g.57428858C>T - GNAS(NM_080425.3):c.538C>T (p.Q180*) - GNAS_000412 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.-37884G>A VUS r.(?) p.(=) - - - g.57428898G>A - GNAS(NM_001077490.2):c.391G>A (p.G131R) - GNAS_000413 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. - c.-37835G>A benign r.(?) p.(=) - - - g.57428947G>A - GNAS(NM_001077490.1):c.440G>A (p.(Arg147Lys)), GNAS(NM_001077490.2):c.440G>A (p.R147K) - GNAS_000354 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-?/. - c.-37835G>A likely benign r.(?) p.(=) - - - g.57428947G>A - GNAS(NM_001077490.1):c.440G>A (p.(Arg147Lys)), GNAS(NM_001077490.2):c.440G>A (p.R147K) - GNAS_000354 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.-37835G>A likely benign r.(?) p.(=) - - - g.57428947G>A - GNAS(NM_001077490.1):c.440G>A (p.(Arg147Lys)), GNAS(NM_001077490.2):c.440G>A (p.R147K) - GNAS_000354 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-37834G>C likely benign r.(?) p.(=) - - - g.57428948G>C - GNAS(NM_001077490.2):c.441G>C (p.R147S) - GNAS_000355 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.-37784T>G VUS r.(?) p.(=) - - - g.57428998T>G - GNAS(NM_001077490.2):c.491T>G (p.L164W) - GNAS_000356 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.-37742G>A VUS r.(?) p.(=) - - - g.57429040G>A - GNAS(NM_001077490.2):c.533G>A (p.R178Q) - GNAS_000357 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
+/. - c.-37715C>A pathogenic r.(?) p.(=) - - - g.57429067C>A - GNAS(NM_001077490.2):c.560C>A (p.S187*) - GNAS_000461 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-37688C>T likely benign r.(?) p.(=) - - - g.57429094C>T - GNAS(NM_001077490.1):c.587C>T (p.(Ser196Leu)) - GNAS_000414 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-37641C>T VUS r.(?) p.(=) - - - g.57429141C>T - GNAS(NM_001077490.2):c.634C>T (p.P212S) - GNAS_000415 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-37574G>A likely benign r.(?) p.(=) - - - g.57429208G>A - GNAS(NM_001077490.2):c.701G>A (p.R234Q) - GNAS_000416 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-37565C>A likely benign r.(?) p.(=) - - - g.57429217C>A - GNAS(NM_001077490.2):c.710C>A (p.A237D) - GNAS_000359 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.-37549T>C likely benign r.(?) p.(=) - - - g.57429233T>C - GNAS(NM_080425.3):c.913T>C (p.S305P) - GNAS_000462 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-37523C>G likely benign r.(?) p.(=) - - - g.57429259C>G - GNAS(NM_001077490.1):c.752C>G (p.(Ala251Gly)) - GNAS_000417 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-37504_-37502del VUS r.(?) p.(=) - - - g.57429278_57429280del - GNAS(NM_001077490.2):c.771_773delGAC (p.T258del) - GNAS_000463 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-37472C>T likely benign r.(?) p.(=) - - - g.57429310C>T - GNAS(NM_001077490.2):c.803C>T (p.S268L) - GNAS_000361 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.-37437C>A VUS r.(?) p.(=) - - - g.57429345C>A - GNAS(NM_001077490.2):c.838C>A (p.P280T) - GNAS_000362 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.-37358G>A VUS r.(?) p.(=) - - - g.57429424G>A - GNAS(NM_001077490.1):c.917G>A (p.(Arg306Gln)) - GNAS_000363 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-/. - c.-37335C>T benign r.(?) p.(=) - - - g.57429447C>T - GNAS(NM_001077490.1):c.940C>T (p.(Arg314Trp)), GNAS(NM_001077490.2):c.940C>T (p.R314W) - GNAS_000419 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-37335C>T likely benign r.(?) p.(=) - - - g.57429447C>T - GNAS(NM_001077490.1):c.940C>T (p.(Arg314Trp)), GNAS(NM_001077490.2):c.940C>T (p.R314W) - GNAS_000419 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. - c.-37335C>T benign r.(?) p.(=) - - - g.57429447C>T - GNAS(NM_001077490.1):c.940C>T (p.(Arg314Trp)), GNAS(NM_001077490.2):c.940C>T (p.R314W) - GNAS_000419 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.-37333G>C likely benign r.(?) p.(=) - - - g.57429449G>C - GNAS(NM_001077490.1):c.942G>C (p.(=)) - GNAS_000420 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-37274_-37266dup likely benign r.(?) p.(=) - - - g.57429508_57429516dup - GNAS(NM_001077490.1):c.992_993insGCAGCCCCT (p.(Gly331_Gln332insGlnProLeu)), GNAS(NM_001077490.2):c.1001_1009dupTGCAGCCCC (p.L334_P336dup) - GNAS_000366 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-/. - c.-37274_-37266dup benign r.(?) p.(=) - - - g.57429508_57429516dup - GNAS(NM_001077490.1):c.992_993insGCAGCCCCT (p.(Gly331_Gln332insGlnProLeu)), GNAS(NM_001077490.2):c.1001_1009dupTGCAGCCCC (p.L334_P336dup) - GNAS_000366 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.-37274_-37266dup benign r.(?) p.(=) - - - g.57429508_57429516dup - GNAS(NM_001077490.1):c.992_993insGCAGCCCCT (p.(Gly331_Gln332insGlnProLeu)), GNAS(NM_001077490.2):c.1001_1009dupTGCAGCCCC (p.L334_P336dup) - GNAS_000366 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-37241C>G likely benign r.(?) p.(=) - - - g.57429541C>G - GNAS(NM_001077490.1):c.1034C>G (p.(Pro345Arg)), GNAS(NM_001077490.2):c.1034C>G (p.P345R) - GNAS_000367 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.-37241C>G VUS r.(?) p.(=) - - - g.57429541C>G - GNAS(NM_001077490.1):c.1034C>G (p.(Pro345Arg)), GNAS(NM_001077490.2):c.1034C>G (p.P345R) - GNAS_000367 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.-37241C>G VUS r.(?) p.(=) - - - g.57429541C>G - GNAS(NM_001077490.1):c.1034C>G (p.(Pro345Arg)), GNAS(NM_001077490.2):c.1034C>G (p.P345R) - GNAS_000367 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-/. - c.-37229_-37203del benign r.(?) p.(=) - - - g.57429553_57429579del - GNAS(NM_001077490.1):c.1041_1067del (p.(Pro349_Ile357del)), GNAS(NM_001077490.2):c.1046_1072delCGACTCCGGGACAGCACCAGCCGATCC (p.P349_I357del) - GNAS_000368 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.-37229_-37203del VUS r.(?) p.(=) - - - g.57429553_57429579del - GNAS(NM_001077490.1):c.1041_1067del (p.(Pro349_Ile357del)), GNAS(NM_001077490.2):c.1046_1072delCGACTCCGGGACAGCACCAGCCGATCC (p.P349_I357del) - GNAS_000368 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.-37222G>A likely benign r.(?) p.(=) - - - g.57429560G>A - GNAS(NM_080425.3):c.1240G>A (p.G414R) - GNAS_000464 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-37182C>A VUS r.(?) p.(=) - - - g.57429600C>A - GNAS(NM_001077490.1):c.1093C>A (p.(Pro365Thr)) - GNAS_000369 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.-37163A>G likely benign r.(?) p.(=) - - - g.57429619A>G - GNAS(NM_001077490.1):c.1112A>G (p.(Gln371Arg)) - GNAS_000423 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-37163_-37128del VUS r.(?) p.(=) - - - g.57429619_57429654del - GNAS(NM_001077490.1):c.1090_1125del (p.(Gln371_Gly382del)) - GNAS_000465 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-37155C>A likely benign r.(?) p.(=) - - - g.57429627C>A - GNAS(NM_001077490.1):c.1120delinsA (p.(Pro374Thr)), GNAS(NM_001077490.2):c.1120C>A (p.P374T) - GNAS_000424 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.-37155C>A likely benign r.(?) p.(=) - - - g.57429627C>A - GNAS(NM_001077490.1):c.1120delinsA (p.(Pro374Thr)), GNAS(NM_001077490.2):c.1120C>A (p.P374T) - GNAS_000424 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.-37132G>A VUS r.(?) p.(=) - - - g.57429650G>A - GNAS(NM_080425.3):c.1330G>A (p.G444R) - GNAS_000370 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.-37127G>A likely benign r.(?) p.(=) - - - g.57429655G>A - GNAS(NM_001077490.1):c.1148G>A (p.(Arg383Gln)) - GNAS_000426 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-37119A>C likely benign r.(?) p.(=) - - - g.57429663A>C - GNAS(NM_001077490.1):c.1156A>C (p.(Thr386Pro)) - GNAS_000427 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-37096G>A VUS r.(?) p.(=) - - - g.57429686G>A - GNAS(NM_080425.3):c.1366G>A (p.G456R) - GNAS_000371 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-/. - c.-37086C>G benign r.(?) p.(=) - - - g.57429696C>G - GNAS(NM_001077490.2):c.1189C>G (p.L397V) - GNAS_000428 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-37068_-37067insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC likely benign r.(?) p.(=) - - - g.57429714_57429715insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC - GNAS(NM_001077490.1):c.1189_1190insTGACGCCCCAGCCGATCCCGACTCCGGGGCGGCCCG (p.(Leu397_Thr398insThrProGlnProIleProThrProGlyArgProVal)), GNAS(NM_001077...) - GNAS_000373 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.-37068_-37067insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC likely benign r.(?) p.(=) - - - g.57429714_57429715insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC - GNAS(NM_001077490.1):c.1189_1190insTGACGCCCCAGCCGATCCCGACTCCGGGGCGGCCCG (p.(Leu397_Thr398insThrProGlnProIleProThrProGlyArgProVal)), GNAS(NM_001077...) - GNAS_000373 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
?/. - c.-37067A>C VUS r.(?) p.(=) - - - g.57429715A>C - GNAS(NM_001077490.1):c.1208A>C (p.(Gln403Pro)) - GNAS_000374 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.-37065_-37064insC VUS r.(?) p.(=) - - - g.57429717_57429718insC - GNAS(NM_001077490.1):c.1210_1211insC (p.?) - GNAS_000466 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-37064T>C VUS r.(?) p.(=) - - - g.57429718T>C - GNAS(NM_001077490.1):c.1211T>C (p.(Met404Thr)) - GNAS_000375 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.-37063G>T VUS r.(?) p.(=) - - - g.57429719G>T - GNAS(NM_001077490.1):c.1212G>T (p.(Met404Ile)) - GNAS_000376 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.-37034C>G likely benign r.(?) p.(=) - - - g.57429748C>G - GNAS(NM_001077490.2):c.1241C>G (p.P414R) - GNAS_000377 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. - c.-37017C>T VUS r.(?) p.(=) - - - g.57429765C>T - GNAS(NM_001077490.1):c.1258C>T (p.(Pro420Ser)) - GNAS_000378 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-/. - c.-37007C>A benign r.(?) p.(=) - - - g.57429775C>A - GNAS(NM_001077490.1):c.1268C>A (p.(Pro423His)), GNAS(NM_001077490.2):c.1268C>A (p.P423H) - GNAS_000379 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
?/. - c.-37007C>A VUS r.(?) p.(=) - - - g.57429775C>A - GNAS(NM_001077490.1):c.1268C>A (p.(Pro423His)), GNAS(NM_001077490.2):c.1268C>A (p.P423H) - GNAS_000379 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.-37000G>A likely benign r.(?) p.(=) - - - g.57429782G>A - GNAS(NM_001077490.1):c.1275G>A (p.(=)) - GNAS_000430 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-36944G>A likely benign r.(?) p.(=) - - - g.57429838G>A - GNAS(NM_001077490.2):c.1331G>A (p.G444E) - GNAS_000380 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-/. - c.-36938C>T benign r.(?) p.(=) - - - g.57429844C>T - GNAS(NM_001077490.2):c.1337C>T (p.P446L) - GNAS_000431 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-36924C>T VUS r.(?) p.(=) - - - g.57429858C>T - - - GNAS_000467 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-36914A>T VUS r.(?) p.(=) - - - g.57429868A>T - GNAS(NM_001077490.2):c.1361A>T (p.Q454L) - GNAS_000432 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-36909C>T VUS r.(?) p.(=) - - - g.57429873C>T - GNAS(NM_080425.3):c.1553C>T (p.P518L) - GNAS_000433 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.-36891G>A likely benign r.(?) p.(=) - - - g.57429891G>A - GNAS(NM_001077490.2):c.1384G>A (p.A462T) - GNAS_000434 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-36814G>A VUS r.(?) p.(=) - - - g.57429968G>A - GNAS(NM_080425.3):c.1648G>A (p.A550T) - GNAS_000436 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-36782C>A VUS r.(?) p.(=) - - - g.57430000C>A - GNAS(NM_001077490.1):c.1493C>A (p.(Ala498Asp)) - GNAS_000381 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-/. - c.-36664C>G benign r.(?) p.(=) - - - g.57430118C>G - GNAS(NM_080425.3):c.1798C>G (p.R600G) - GNAS_000382 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-/. - c.-36664C>G benign r.(?) p.(=) - - - g.57430118C>G - GNAS(NM_080425.3):c.1798C>G (p.R600G) - GNAS_000382 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.-36539G>C VUS r.(?) p.(=) - - - g.57430243G>C - GNAS(NM_001077490.2):c.1736G>C (p.W579S) - GNAS_000437 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.-36460C>T VUS r.(?) p.(=) - - - g.57430322C>T - GNAS(NM_001077490.1):c.1815C>T (p.(=)) - GNAS_000384 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-?/. - c.-36437C>G likely benign r.(?) p.(=) - - - g.57430345C>G - GNAS(NM_001077490.2):c.1838C>G (p.T613R) - GNAS_000468 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
Legend   « First ‹ Prev     1 2 3 4 5 6     Next › Last »