Unique variants in the LRSAM1 gene

Information The variants shown are described using the NM_138361.5 transcript reference sequence.

67 entries on 1 page. Showing entries 1 - 67.
Legend   How to query  




AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







?/. 2 16, 6 c.? r.? p.? - VUS g.? - c.1198C>T (Arg400Trp), c.284C>T (Ala95Val) - PTCH1_000000 - PubMed: Ganapathy 2019 ClinVar-RCV000649924.1 rs570248730, rs749575647 Germline - - - - - Johan den Dunnen
?/. 1 - c.175-3C>G r.spl? p.? - VUS g.130219592C>G g.127457313C>G - - LRSAM1_000041 - - - - Germline - - - - - Andreas Laner
?/. 1 - c.206C>G r.(?) p.(Ser69Cys) - VUS g.130219626C>G g.127457347C>G - - LRSAM1_000042 - - - rs942116544 Germline - - - - - Andreas Laner
-/. 2 - c.249C>T r.(?) p.(Ile83=) - benign g.130219669C>T g.127457390C>T LRSAM1(NM_138361.5):c.249C>T (p.I83=) - LRSAM1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_AMC
-/. 1 - c.252+8G>A r.(=) p.(=) - benign g.130219680G>A g.127457401G>A LRSAM1(NM_138361.5):c.252+8G>A - LRSAM1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.253-13C>G r.(=) p.(=) - likely benign g.130221269C>G g.127458990C>G LRSAM1(NM_138361.5):c.253-13C>G - LRSAM1_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 2 - c.268G>A r.(?) p.(Asp90Asn) - likely benign g.130221297G>A g.127459018G>A LRSAM1(NM_138361.5):c.268G>A (p.D90N) - LRSAM1_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_AMC
?/. 1 - c.284C>T r.(?) p.(Ala95Val) - VUS g.130221313C>T g.127459034C>T LRSAM1(NM_138361.5):c.284C>T (p.A95V) - LRSAM1_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.406+15G>T r.(=) p.(=) - likely benign g.130223551G>T g.127461272G>T LRSAM1(NM_138361.5):c.406+15G>T - LRSAM1_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.497C>T r.(?) p.(Pro166Leu) - VUS g.130224621C>T g.127462342C>T - - LRSAM1_000043 - - - rs142085060 Germline - - - - - Andreas Laner
?/. 1 - c.517C>T r.(?) p.(Arg173Ter) - VUS g.130224641C>T g.127462362C>T - - LRSAM1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.528+1G>C r.spl p.? ACMG likely pathogenic g.130224653G>C g.127462374G>C - - LRSAM1_000044 ACMG grading: PVS1,PM2 - - - Germline - - - - - Andreas Laner
+?/. 1 - c.529-2A>G r.spl p.? - likely pathogenic g.130230017A>G g.127467738A>G - - LRSAM1_000022 - - - - Unknown - - - - - IMGAG
-/. 1 - c.548C>T r.(?) p.(Ser183Leu) - benign g.130230038C>T g.127467759C>T LRSAM1(NM_138361.5):c.548C>T (p.S183L) - LRSAM1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 2 - c.586G>A r.(?) p.(Gly196Ser) - VUS g.130230076G>A g.127467797G>A LRSAM1(NM_138361.5):c.586G>A (p.G196S) - LRSAM1_000026 VKGL data sharing initiative Nederland - - rs148059394 CLASSIFICATION record, Germline - - - - - Andreas Laner, VKGL-NL_VUmc
?/. 1 - c.593C>T r.(?) p.(Ala198Val) - VUS g.130230083C>T g.127467804C>T LRSAM1(NM_138361.5):c.593C>T (p.A198V) - LRSAM1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.619+1G>A r.spl? p.? - VUS g.130230110G>A g.127467831G>A - - LRSAM1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 1 - c.620-15T>C r.(=) p.(=) - benign g.130236065T>C g.127473786T>C LRSAM1(NM_138361.5):c.620-15T>C - LRSAM1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+?/. 1 - c.649C>T r.(?) p.(Gln217*) ACMG likely pathogenic g.130236109C>T g.127473830C>T - - LRSAM1_000045 ACMG grading: PVS1,PM2 - - rs868415081 Germline - - - - - Andreas Laner
-?/. 1 - c.786G>A r.(?) p.(Gln262=) - likely benign g.130241667G>A g.127479388G>A LRSAM1(NM_138361.5):c.786G>A (p.Q262=) - LRSAM1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.893C>T r.(?) p.(Thr298Met) - VUS g.130241774C>T g.127479495C>T - - LRSAM1_000046 - - - rs747368361 Germline - - - - - Andreas Laner
-?/. 1 - c.903+11C>T r.(=) p.(=) - likely benign g.130241795C>T - LRSAM1(NM_138361.5):c.903+11C>T - LRSAM1_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 2 - c.904-9C>T r.(=) p.(=) - benign g.130242109C>T g.127479830C>T LRSAM1(NM_138361.5):c.904-9C>T - LRSAM1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_AMC
-/. 2 - c.952A>G r.(?) p.(Asn318Asp) - benign g.130242166A>G g.127479887A>G LRSAM1(NM_138361.5):c.952A>G (p.N318D) - LRSAM1_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_AMC
-?/. 2 - c.965A>G r.(?) p.(Gln322Arg) - likely benign g.130242179A>G g.127479900A>G LRSAM1(NM_138361.5):c.965A>G (p.Q322R) - LRSAM1_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_AMC
-?/. 1 - c.1026G>T r.(?) p.(Leu342=) - likely benign g.130242240G>T - LRSAM1(NM_138361.5):c.1026G>T (p.L342=) - LRSAM1_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.1027C>T r.(?) p.(Leu343=) - likely benign g.130242241C>T - LRSAM1(NM_138361.5):c.1027C>T (p.L343=) - LRSAM1_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.1044-9T>C r.(=) p.(=) - benign g.130243453T>C g.127481174T>C LRSAM1(NM_138361.5):c.1044-9T>C - LRSAM1_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+?/. 1 - c.1144C>T r.(?) p.(Arg382*) ACMG likely pathogenic g.130245284C>T g.127483005C>T - - LRSAM1_000047 ACMG grading: PVS1,PM2 - - rs752177472 Germline - - - - - Andreas Laner
?/. 1 - c.1199G>A r.(?) p.(Arg400Gln) - VUS g.130248054G>A g.127485775G>A LRSAM1(NM_138361.5):c.1199G>A (p.R400Q) - LRSAM1_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.1225C>G r.(?) p.(Gln409Glu) - likely benign g.130248080C>G g.127485801C>G LRSAM1(NM_138361.5):c.1225C>G (p.Q409E) - LRSAM1_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+?/. 1 - c.1342C>T r.(?) p.(Gln448*) - likely pathogenic g.130250037C>T g.127487758C>T - - LRSAM1_000048 - - - - Germline - - - - - Andreas Laner
-/. 1 - c.1368G>A r.(?) p.(Ala456=) - benign g.130251743G>A g.127489464G>A LRSAM1(NM_138361.5):c.1368G>A (p.A456=) - LRSAM1_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 - c.1527G>A r.(?) p.(Trp509Ter) - pathogenic g.130255104G>A g.127492825G>A LRSAM1(NM_138361.5):c.1527G>A (p.W509*) - LRSAM1_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1589G>A r.(?) p.(Arg530Gln) - VUS g.130255166G>A g.127492887G>A LRSAM1(NM_138361.5):c.1589G>A (p.R530Q) - LRSAM1_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.1632G>A r.(?) p.(Gln544=) - likely benign g.130257631G>A g.127495352G>A LRSAM1(NM_138361.5):c.1632G>A (p.Q544=) - LRSAM1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 21 c.1673A>G r.(?) p.(Gln558Arg) - VUS g.130257672A>G - - - LRSAM1_000057 - - - - Germline/De novo (untested) - - - - - Gemeinschaftspraxis für Humangenetik Dresden
?/. 1 - c.1780C>T r.(?) p.(Arg594Cys) - VUS g.130258324C>T g.127496045C>T - - LRSAM1_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 2 - c.1830+6C>T r.(=) p.(=) - benign g.130258380C>T g.127496101C>T LRSAM1(NM_138361.5):c.1830+6C>T - LRSAM1_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_AMC
-?/. 2 - c.1860C>T r.(?) p.(His620=) - likely benign g.130259561C>T g.127497282C>T LRSAM1(NM_138361.5):c.1860C>T (p.H620=) - LRSAM1_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_AMC
-/. 2 - c.1912+5A>C r.spl? p.? - benign g.130259618A>C g.127497339A>C LRSAM1(NM_138361.5):c.1912+5A>C - LRSAM1_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_AMC
+/. 1 - c.1913-1G>A r.1913_1914del p.Glu638Alafs*7 - pathogenic (recessive) g.130263288G>A g.127501009G>A - - LRSAM1_000016 gene localized by homozygosity mapping PubMed: Guernsey 2010 - - Germline yes - - - - Johan den Dunnen
+?/. 1 - c.1913_1914del r.(?) p.(Glu638Alafs*7) ACMG pathogenic (recessive) g.130263289_130263290del g.127501010_127501011del - - LRSAM1_000054 submission for publication Reilich et al, 2020 (submitted) - - - Germline ? - - - - Andreas Laner
+?/. 2 - c.1957dup r.(?) p.(Gln653Profs*5) ACMG likely pathogenic g.130263328dup, g.130263333dup g.127501054dup - - LRSAM1_000015, LRSAM1_000049 ACMG grading: PM2,PVS1, ACMG grading: PVS1,PM2 - - rs775965001 Germline - - - - - Andreas Laner
-?/. 1 - c.1974T>C r.(?) p.(Ser658=) - likely benign g.130263350T>C g.127501071T>C LRSAM1(NM_138361.5):c.1974T>C (p.S658=) - FAM129B_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.1975G>A r.(?) p.(Val659Met) - benign g.130263351G>A - LRSAM1(NM_138361.5):c.1975G>A (p.V659M) - FAM129B_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+?/. 1 - c.2011C>T r.(?) p.(Gln671*) - likely pathogenic g.130263387C>T g.127501108C>T - - LRSAM1_000051 - - - rs876661247 Germline - - - - - Andreas Laner
+?/. 2 - c.2011del r.(?) p.(Gln671Argfs*15) ACMG likely pathogenic g.130263387del g.127501108del 2011delC - LRSAM1_000050 ACMG grading: PVS1,PM2 - - - Germline - - - - - Andreas Laner
+/. 1 - c.2021_2024del r.(?) p.(Glu674Valfs*11) - pathogenic (dominant) g.130263397_130263400del g.127501118_127501121del - - LRSAM1_000019 - PubMed: Zhao 2018 - - Germline yes - - - - Johan den Dunnen
+?/. 1 - c.2033G>A r.(?) p.(Cys678Tyr) - likely pathogenic g.130263409G>A g.127501130G>A - - LRSAM1_000023 - - - - Unknown - - - - - IMGAG
+?/. 2 - c.2038del r.(?) p.(Glu680Asnfs*6), p.(Glu680AsnfsTer6) ACMG likely pathogenic, likely pathogenic (dominant) g.130263414del g.127501135del 2038delG - LRSAM1_000038 ACMG: PVS1,PM2, submission for publication Reilich et al, 2020 (submitted) - - - Germline ? - - - - Andreas Laner
+/. 1 24i c.2046+1G>T r.2046_2047ins[u;2046+2_2046+63] p.Glu682_Ala683ins21 - pathogenic (dominant) g.130263423G>T g.127501144G>T - - LRSAM1_000021 - PubMed: Engeholm 2014 - - Germline yes - - - - Johan den Dunnen
-/. 1 - c.2046+16T>C r.(=) p.(=) - benign g.130263438T>C g.127501159T>C LRSAM1(NM_138361.5):c.2046+16T>C - FAM129B_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/., +?/. 3 24i c.2047-1G>A r.(?), r.2047del, r.spl p.?, p.Ala683Profs*3 ACMG likely pathogenic (dominant), pathogenic, pathogenic (dominant) g.130265052G>A g.127502773G>A c.2047-1G>A, (p.Ala683Profs*3); Nicolaou, et al., 2013; Dohrn, et al., 2017 - LRSAM1_000017 submission for publication Reilich et al, 2020 (submitted) PubMed: Dohrn 2017, Journal: Dohrn 2017, PubMed: Nicolaou 2013 - - Germline ?, yes 1/612 cases - - - Johan den Dunnen, Andreas Laner
+?/. 1 - c.(2046+1_2047-1)_(*1_?)del r.? p.? ACMG likely pathogenic (dominant) g.(130263423_130265052)_(130265179_?)del g.(127501144_127502773)_(127502900_?)del deletion Ex25; Mortreux, et al., 2019 - LRSAM1_000056 submission for publication Reilich et al, 2020 (submitted); Truncated protein without RING domain - - - Germline ? - - - - Andreas Laner
+/., ?/. 3 - c.2054T>G r.(?) p.(Met685Arg) - pathogenic, VUS g.130265060T>G g.127502781T>G LRSAM1(NM_138361.5):c.2054T>G (p.M685R) - LRSAM1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_AMC
+?/., ?/. 2 - c.2068T>C r.(?) p.(Cys690Arg) ACMG likely pathogenic (dominant), VUS g.130265074T>C g.127502795T>C - - LRSAM1_000052 ACMG grading: PM2,PP3, submission for publication Reilich et al, 2020 (submitted) - - rs879253755 Germline ? - - - - Andreas Laner
+?/. 1 - c.2074C>A r.(?) p.(His692Asn) ACMG likely pathogenic (dominant) g.130265080C>A g.127502801C>A - - LRSAM1_000055 1 more item - - - Germline ? - - - - Andreas Laner
./. 1 - c.2075_2087del r.(?) p.(His692Profs*39) ACMG likely pathogenic g.130265081_130265093del g.127502802_127502814del - - LRSAM1_000001 - PubMed: Trujillano 2017 - - Germline - - - - - Daniel Trujillano
+/. 1 - c.2080T>C r.(?) p.(Cys694Arg) - pathogenic (dominant) g.130265086T>C g.127502807T>C - - LRSAM1_000020 tested variant in vitro PubMed: Hu 2016 - - Germline yes - - - - Johan den Dunnen
+/. 1 25 c.2081G>A r.(?) p.(Cys694Tyr) - pathogenic (dominant) g.130265087G>A g.127502808G>A - - LRSAM1_000018 - PubMed: Peeters 2016 - - Germline yes - - - - Johan den Dunnen
?/. 1 - c.2087G>C r.(?) p.(Cys696Ser) - VUS g.130265093G>C g.127502814G>C LRSAM1(NM_138361.5):c.2087G>C (p.C696S) - FAM129B_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+?/. 1 - c.2088C>G r.(?) p.(Cys696Trp) - likely pathogenic g.130265094C>G g.127502815C>G LRSAM1(NM_138361.5):c.2088C>G (p.C696W) - FAM129B_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.2090A>G r.(?) p.(Gln697Arg) - VUS g.130265096A>G g.127502817A>G - - LRSAM1_000053 - - - - Germline - - - - - Andreas Laner
?/. 1 - c.2104_2133dup r.(?) p.(Pro702_Gln711dup) - VUS g.130265110_130265139dup g.127502831_127502860dup LRSAM1(NM_138361.5):c.2104_2133dupCCACTGCGCACCTGCCCGCTGTGCCGCCAG (p.P702_Q711dup) - FAM129B_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 - c.2121_2122dup r.(?) p.(Leu708Argfs*28) - pathogenic (dominant) g.130265127_130265128dup g.127502848_127502849dup 2121_2122insGC (Leu708Argfx28) - LRSAM1_000009 gene mapped using linkage (LOD score 5.12); variant not in 676 control chromosomes PubMed: Weterman 2012 - - Germline yes - - - - Johan den Dunnen
-/. 1 - c.2157C>T r.(?) p.(Ile719=) - benign g.130265163C>T g.127502884C>T LRSAM1(NM_138361.5):c.2157C>T (p.I719=) - FAM129B_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
Legend   How to query