Unique variants in gene LRSAM1

Information The variants shown are described using the transcript reference sequence.

45 entries on 1 page. Showing entries 1 - 45.




AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







-/. 2 - c.249C>T r.(?) p.(Ile83=) - benign g.130219669C>T g.127457390C>T LRSAM1(NM_138361.5):c.249C>T (p.I83=) - LRSAM1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC, VKGL-NL_Groningen
-/. 1 - c.252+8G>A r.(=) p.(=) - benign g.130219680G>A g.127457401G>A LRSAM1(NM_138361.5):c.252+8G>A - LRSAM1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.253-13C>G r.(=) p.(=) - likely benign g.130221269C>G g.127458990C>G LRSAM1(NM_138361.5):c.253-13C>G - LRSAM1_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.268G>A r.(?) p.(Asp90Asn) - likely benign g.130221297G>A g.127459018G>A LRSAM1(NM_138361.5):c.268G>A (p.D90N) - LRSAM1_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.284C>T r.(?) p.(Ala95Val) - VUS g.130221313C>T g.127459034C>T LRSAM1(NM_138361.5):c.284C>T (p.A95V) - LRSAM1_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.406+15G>T r.(=) p.(=) - likely benign g.130223551G>T g.127461272G>T LRSAM1(NM_138361.5):c.406+15G>T - LRSAM1_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.517C>T r.(?) p.(Arg173Ter) - VUS g.130224641C>T g.127462362C>T - - LRSAM1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.529-2A>G r.spl p.? - likely pathogenic g.130230017A>G g.127467738A>G - - LRSAM1_000022 - - - - Unknown - - - - - IMGAG
-/. 1 - c.548C>T r.(?) p.(Ser183Leu) - benign g.130230038C>T g.127467759C>T LRSAM1(NM_138361.5):c.548C>T (p.S183L) - LRSAM1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.586G>A r.(?) p.(Gly196Ser) - VUS g.130230076G>A g.127467797G>A LRSAM1(NM_138361.5):c.586G>A (p.G196S) - LRSAM1_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.593C>T r.(?) p.(Ala198Val) - VUS g.130230083C>T g.127467804C>T LRSAM1(NM_138361.5):c.593C>T (p.A198V) - LRSAM1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.619+1G>A r.spl? p.? - VUS g.130230110G>A g.127467831G>A - - LRSAM1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 1 - c.620-15T>C r.(=) p.(=) - benign g.130236065T>C g.127473786T>C LRSAM1(NM_138361.5):c.620-15T>C - LRSAM1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.786G>A r.(?) p.(Gln262=) - likely benign g.130241667G>A g.127479388G>A LRSAM1(NM_138361.5):c.786G>A (p.Q262=) - LRSAM1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 2 - c.904-9C>T r.(=) p.(=) - benign g.130242109C>T g.127479830C>T LRSAM1(NM_138361.5):c.904-9C>T - LRSAM1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC, VKGL-NL_Groningen
-/. 2 - c.952A>G r.(?) p.(Asn318Asp) - benign g.130242166A>G g.127479887A>G LRSAM1(NM_138361.5):c.952A>G (p.N318D) - LRSAM1_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC, VKGL-NL_Groningen
-?/. 2 - c.965A>G r.(?) p.(Gln322Arg) - likely benign g.130242179A>G g.127479900A>G LRSAM1(NM_138361.5):c.965A>G (p.Q322R) - LRSAM1_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC, VKGL-NL_Utrecht
-/. 1 - c.1044-9T>C r.(=) p.(=) - benign g.130243453T>C g.127481174T>C LRSAM1(NM_138361.5):c.1044-9T>C - LRSAM1_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.1199G>A r.(?) p.(Arg400Gln) - VUS g.130248054G>A g.127485775G>A LRSAM1(NM_138361.5):c.1199G>A (p.R400Q) - LRSAM1_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.1225C>G r.(?) p.(Gln409Glu) - likely benign g.130248080C>G g.127485801C>G LRSAM1(NM_138361.5):c.1225C>G (p.Q409E) - LRSAM1_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.1368G>A r.(?) p.(Ala456=) - benign g.130251743G>A g.127489464G>A LRSAM1(NM_138361.5):c.1368G>A (p.A456=) - LRSAM1_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 - c.1527G>A r.(?) p.(Trp509Ter) - pathogenic g.130255104G>A g.127492825G>A LRSAM1(NM_138361.5):c.1527G>A (p.W509*) - LRSAM1_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1589G>A r.(?) p.(Arg530Gln) - VUS g.130255166G>A g.127492887G>A LRSAM1(NM_138361.5):c.1589G>A (p.R530Q) - LRSAM1_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.1632G>A r.(?) p.(Gln544=) - likely benign g.130257631G>A g.127495352G>A LRSAM1(NM_138361.5):c.1632G>A (p.Q544=) - LRSAM1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.1780C>T r.(?) p.(Arg594Cys) - VUS g.130258324C>T g.127496045C>T - - LRSAM1_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 2 - c.1830+6C>T r.(=) p.(=) - benign g.130258380C>T g.127496101C>T LRSAM1(NM_138361.5):c.1830+6C>T - LRSAM1_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_AMC
-?/. 2 - c.1860C>T r.(?) p.(His620=) - likely benign g.130259561C>T g.127497282C>T LRSAM1(NM_138361.5):c.1860C>T (p.H620=) - LRSAM1_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC, VKGL-NL_Utrecht
-/. 2 - c.1912+5A>C r.spl? p.? - benign g.130259618A>C g.127497339A>C LRSAM1(NM_138361.5):c.1912+5A>C - LRSAM1_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC, VKGL-NL_Groningen
+/. 1 - c.1913-1G>A r.1913_1914del p.Glu638Alafs*7 - pathogenic (recessive) g.130263288G>A g.127501009G>A - - LRSAM1_000016 gene localized by homozygosity mapping PubMed: Guernsey 2010 - - Germline yes - - - - Johan den Dunnen
-?/. 1 - c.1974T>C r.(?) p.(Ser658=) - likely benign g.130263350T>C g.127501071T>C LRSAM1(NM_138361.5):c.1974T>C (p.S658=) - FAM129B_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 - c.2021_2024del r.(?) p.(Glu674Valfs*11) - pathogenic (dominant) g.130263397_130263400del g.127501118_127501121del - - LRSAM1_000019 - PubMed: Zhao 2018 - - Germline yes - - - - Johan den Dunnen
+?/. 1 - c.2033G>A r.(?) p.(Cys678Tyr) - likely pathogenic g.130263409G>A g.127501130G>A - - LRSAM1_000023 - - - - Unknown - - - - - IMGAG
+?/. 1 - c.2038del r.(?) p.(Glu680AsnfsTer6) ACMG likely pathogenic g.130263414del g.127501135del - - LRSAM1_000038 ACMG: PVS1,PM2 - - - Germline - - - - - Andreas Laner
+/. 1 24i c.2046+1G>T r.2046_2047ins[u;2046+2_2046+63] p.Glu682_Ala683ins21 - pathogenic (dominant) g.130263423G>T g.127501144G>T - - LRSAM1_000021 - PubMed: Engeholm 2014 - - Germline yes - - - - Johan den Dunnen
-/. 1 - c.2046+16T>C r.(=) p.(=) - benign g.130263438T>C g.127501159T>C LRSAM1(NM_138361.5):c.2046+16T>C - FAM129B_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. 2 24i c.2047-1G>A r.(?), r.2047del p.?, p.Ala683Profs*3 - pathogenic, pathogenic (dominant) g.130265052G>A g.127502773G>A - - LRSAM1_000017 - PubMed: Dohrn 2017, Journal: Dohrn 2017, PubMed: Nicolaou 2013 - - Germline yes 1/612 cases - - - Johan den Dunnen
+/., ?/. 3 - c.2054T>G r.(?) p.(Met685Arg) - pathogenic, VUS g.130265060T>G g.127502781T>G LRSAM1(NM_138361.5):c.2054T>G (p.M685R) - LRSAM1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_AMC, VKGL-NL_Nijmegen
./. 1 - c.2075_2087del r.(?) p.(His692Profs*39) ACMG likely pathogenic g.130265081_130265093del g.127502802_127502814del - - LRSAM1_000001 - Trujillano et al., submitted - - Germline - - - - - Daniel Trujillano
+/. 1 - c.2080T>C r.(?) p.(Cys694Arg) - pathogenic (dominant) g.130265086T>C g.127502807T>C - - LRSAM1_000020 tested variant in vitro PubMed: Hu 2016 - - Germline yes - - - - Johan den Dunnen
+/. 1 25 c.2081G>A r.(?) p.(Cys694Tyr) - pathogenic (dominant) g.130265087G>A g.127502808G>A - - LRSAM1_000018 - PubMed: Peeters 2016 - - Germline yes - - - - Johan den Dunnen
?/. 1 - c.2087G>C r.(?) p.(Cys696Ser) - VUS g.130265093G>C g.127502814G>C LRSAM1(NM_138361.5):c.2087G>C (p.C696S) - FAM129B_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+?/. 1 - c.2088C>G r.(?) p.(Cys696Trp) - likely pathogenic g.130265094C>G g.127502815C>G LRSAM1(NM_138361.5):c.2088C>G (p.C696W) - FAM129B_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.2104_2133dup r.(?) p.(Pro702_Gln711dup) - VUS g.130265110_130265139dup g.127502831_127502860dup LRSAM1(NM_138361.5):c.2104_2133dupCCACTGCGCACCTGCCCGCTGTGCCGCCAG (p.P702_Q711dup) - FAM129B_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+/. 1 - c.2121_2122dup r.(?) p.(Leu708Argfs*28) - pathogenic (dominant) g.130265127_130265128dup g.127502848_127502849dup 2121_2122insGC (Leu708Argfx28) - LRSAM1_000009 gene mapped using linkage (LOD score 5.12); variant not in 676 control chromosomes PubMed: Weterman 2012 - - Germline yes - - - - Johan den Dunnen
-/. 1 - c.2157C>T r.(?) p.(Ile719=) - benign g.130265163C>T g.127502884C>T LRSAM1(NM_138361.5):c.2157C>T (p.I719=) - FAM129B_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC