Full data view for gene LRSAM1

Information The variants shown are described using the NM_138361.5 transcript reference sequence.

85 entries on 1 page. Showing entries 1 - 85.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Allele     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Template     

Technique     

Tissue     

Remarks     

Disease     

ID_report     

Reference     

Remarks     

Gender     

Consanguinity     

Country     

Population     

Age at death     

VIP     

Data_av     

Treatment     

Panel size     

Owner     
?/. 6 c.? r.? p.? Both (homozygous) - VUS g.? - c.284C>T (Ala95Val) - PTCH1_000000 - PubMed: Ganapathy 2019 ClinVar-RCV000649924.1 rs570248730 Germline - - - 0 - DNA SEQ-NG - TruSight One panel ? S-1738 PubMed: Ganapathy 2019 - - - India - - 0 - - 1 Johan den Dunnen
?/. 16 c.? r.? p.? Unknown - VUS g.? - c.1198C>T (Arg400Trp) - PTCH1_000000 - PubMed: Ganapathy 2019 - rs749575647 Germline - - - 0 - DNA SEQ-NG - TruSight One panel ? S-661 PubMed: Ganapathy 2019 - - - India - - 0 - - 1 Johan den Dunnen
?/. - c.175-3C>G r.spl? p.? Unknown - VUS g.130219592C>G g.127457313C>G - - LRSAM1_000041 - - - - Germline - - - 0 - DNA SEQ-NG-S - - ? - - - M - - - - 0 - - 1 Andreas Laner
?/. - c.206C>G r.(?) p.(Ser69Cys) Unknown - VUS g.130219626C>G g.127457347C>G - - LRSAM1_000042 - - - rs942116544 Germline - - - 0 - DNA SEQ-NG-S - - ? - - - M - - - - 0 - - 1 Andreas Laner
-/. - c.249C>T r.(?) p.(Ile83=) Unknown - benign g.130219669C>T g.127457390C>T LRSAM1(NM_138361.5):c.249C>T (p.I83=) - LRSAM1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.249C>T r.(?) p.(Ile83=) Unknown - benign g.130219669C>T g.127457390C>T LRSAM1(NM_138361.5):c.249C>T (p.I83=) - LRSAM1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.252+8G>A r.(=) p.(=) Unknown - benign g.130219680G>A g.127457401G>A LRSAM1(NM_138361.5):c.252+8G>A - LRSAM1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.253-13C>G r.(=) p.(=) Unknown - likely benign g.130221269C>G g.127458990C>G LRSAM1(NM_138361.5):c.253-13C>G - LRSAM1_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.268G>A r.(?) p.(Asp90Asn) Unknown - likely benign g.130221297G>A g.127459018G>A LRSAM1(NM_138361.5):c.268G>A (p.D90N) - LRSAM1_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.268G>A r.(?) p.(Asp90Asn) Unknown - likely benign g.130221297G>A - LRSAM1(NM_138361.5):c.268G>A (p.D90N) - LRSAM1_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.284C>T r.(?) p.(Ala95Val) Unknown - VUS g.130221313C>T g.127459034C>T LRSAM1(NM_138361.5):c.284C>T (p.A95V) - LRSAM1_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.406+15G>T r.(=) p.(=) Unknown - likely benign g.130223551G>T g.127461272G>T LRSAM1(NM_138361.5):c.406+15G>T - LRSAM1_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.497C>T r.(?) p.(Pro166Leu) Unknown - VUS g.130224621C>T g.127462342C>T - - LRSAM1_000043 - - - rs142085060 Germline - - - 0 - DNA SEQ-NG-S - - ? - - - M - - - - 0 - - 1 Andreas Laner
?/. - c.517C>T r.(?) p.(Arg173Ter) Unknown - VUS g.130224641C>T g.127462362C>T - - LRSAM1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+?/. - c.528+1G>C r.spl p.? Both (homozygous) ACMG likely pathogenic g.130224653G>C g.127462374G>C - - LRSAM1_000044 ACMG grading: PVS1,PM2 - - - Germline - - - 0 - DNA SEQ-NG-S - - ? - - - M - - - - 0 - - 1 Andreas Laner
+?/. - c.529-2A>G r.spl p.? Unknown - likely pathogenic g.130230017A>G g.127467738A>G - - LRSAM1_000022 - - - - Unknown - - - 0 - DNA SEQ - - ? - - - F - - - - 0 - - 1 IMGAG
-/. - c.548C>T r.(?) p.(Ser183Leu) Unknown - benign g.130230038C>T g.127467759C>T LRSAM1(NM_138361.5):c.548C>T (p.S183L) - LRSAM1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.586G>A r.(?) p.(Gly196Ser) Unknown - VUS g.130230076G>A g.127467797G>A - - LRSAM1_000026 - - - rs148059394 Germline - - - 0 - DNA SEQ-NG-S - - ? - - - M - - - - 0 - - 1 Andreas Laner
?/. - c.586G>A r.(?) p.(Gly196Ser) Unknown - VUS g.130230076G>A - LRSAM1(NM_138361.5):c.586G>A (p.G196S) - LRSAM1_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.593C>T r.(?) p.(Ala198Val) Unknown - VUS g.130230083C>T g.127467804C>T LRSAM1(NM_138361.5):c.593C>T (p.A198V) - LRSAM1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.619+1G>A r.spl? p.? Unknown - VUS g.130230110G>A g.127467831G>A - - LRSAM1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.620-15T>C r.(=) p.(=) Unknown - benign g.130236065T>C g.127473786T>C LRSAM1(NM_138361.5):c.620-15T>C - LRSAM1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+?/. - c.649C>T r.(?) p.(Gln217*) Unknown ACMG likely pathogenic g.130236109C>T g.127473830C>T - - LRSAM1_000045 ACMG grading: PVS1,PM2 - - rs868415081 Germline - - - 0 - DNA SEQ-NG-S - - ? - - - M - - - - 0 - - 1 Andreas Laner
-?/. - c.786G>A r.(?) p.(Gln262=) Unknown - likely benign g.130241667G>A g.127479388G>A LRSAM1(NM_138361.5):c.786G>A (p.Q262=) - LRSAM1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.893C>T r.(?) p.(Thr298Met) Unknown - VUS g.130241774C>T g.127479495C>T - - LRSAM1_000046 - - - rs747368361 Germline - - - 0 - DNA SEQ-NG-S - - ? - - - M - - - - 0 - - 1 Andreas Laner
-?/. - c.903+11C>T r.(=) p.(=) Unknown - likely benign g.130241795C>T - LRSAM1(NM_138361.5):c.903+11C>T - LRSAM1_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.904-9C>T r.(=) p.(=) Unknown - benign g.130242109C>T g.127479830C>T LRSAM1(NM_138361.5):c.904-9C>T - LRSAM1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.904-9C>T r.(=) p.(=) Unknown - benign g.130242109C>T g.127479830C>T LRSAM1(NM_138361.5):c.904-9C>T - LRSAM1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.952A>G r.(?) p.(Asn318Asp) Unknown - benign g.130242166A>G g.127479887A>G LRSAM1(NM_138361.5):c.952A>G (p.N318D) - LRSAM1_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.952A>G r.(?) p.(Asn318Asp) Unknown - benign g.130242166A>G g.127479887A>G LRSAM1(NM_138361.5):c.952A>G (p.N318D) - LRSAM1_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.965A>G r.(?) p.(Gln322Arg) Unknown - likely benign g.130242179A>G g.127479900A>G LRSAM1(NM_138361.5):c.965A>G (p.Q322R) - LRSAM1_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.965A>G r.(?) p.(Gln322Arg) Unknown - likely benign g.130242179A>G g.127479900A>G LRSAM1(NM_138361.5):c.965A>G (p.Q322R) - LRSAM1_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1026G>T r.(?) p.(Leu342=) Unknown - likely benign g.130242240G>T - LRSAM1(NM_138361.5):c.1026G>T (p.L342=) - LRSAM1_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1027C>T r.(?) p.(Leu343=) Unknown - likely benign g.130242241C>T - LRSAM1(NM_138361.5):c.1027C>T (p.L343=) - LRSAM1_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1044-9T>C r.(=) p.(=) Unknown - benign g.130243453T>C g.127481174T>C LRSAM1(NM_138361.5):c.1044-9T>C - LRSAM1_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.1144C>T r.(?) p.(Arg382*) Unknown ACMG likely pathogenic g.130245284C>T g.127483005C>T - - LRSAM1_000047 ACMG grading: PVS1,PM2 - - rs752177472 Germline - - - 0 - DNA SEQ-NG-S - - ? - - - M - - - - 0 - - 1 Andreas Laner
?/. - c.1199G>A r.(?) p.(Arg400Gln) Unknown - VUS g.130248054G>A g.127485775G>A LRSAM1(NM_138361.5):c.1199G>A (p.R400Q) - LRSAM1_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1225C>G r.(?) p.(Gln409Glu) Unknown - likely benign g.130248080C>G g.127485801C>G LRSAM1(NM_138361.5):c.1225C>G (p.Q409E) - LRSAM1_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.1342C>T r.(?) p.(Gln448*) Unknown - likely pathogenic g.130250037C>T g.127487758C>T - - LRSAM1_000048 - - - - Germline - - - 0 - DNA SEQ-NG-S - - ? - - - M - - - - 0 - - 1 Andreas Laner
-/. - c.1368G>A r.(?) p.(Ala456=) Unknown - benign g.130251743G>A g.127489464G>A LRSAM1(NM_138361.5):c.1368G>A (p.A456=) - LRSAM1_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.1527G>A r.(?) p.(Trp509Ter) Unknown - pathogenic g.130255104G>A g.127492825G>A LRSAM1(NM_138361.5):c.1527G>A (p.W509*) - LRSAM1_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1589G>A r.(?) p.(Arg530Gln) Unknown - VUS g.130255166G>A g.127492887G>A LRSAM1(NM_138361.5):c.1589G>A (p.R530Q) - LRSAM1_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1632G>A r.(?) p.(Gln544=) Unknown - likely benign g.130257631G>A g.127495352G>A LRSAM1(NM_138361.5):c.1632G>A (p.Q544=) - LRSAM1_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. 21 c.1673A>G r.(?) p.(Gln558Arg) Unknown - VUS g.130257672A>G - - - LRSAM1_000057 - - - - Germline/De novo (untested) - - - - - DNA SEQ-NG - - CMT-2P - - - - - - - - - - - 1 Gemeinschaftspraxis für Humangenetik Dresden
?/. - c.1780C>T r.(?) p.(Arg594Cys) Unknown - VUS g.130258324C>T g.127496045C>T - - LRSAM1_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1830+6C>T r.(=) p.(=) Unknown - benign g.130258380C>T g.127496101C>T LRSAM1(NM_138361.5):c.1830+6C>T - LRSAM1_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1830+6C>T r.(=) p.(=) Unknown - benign g.130258380C>T g.127496101C>T LRSAM1(NM_138361.5):c.1830+6C>T - LRSAM1_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1860C>T r.(?) p.(His620=) Unknown - likely benign g.130259561C>T g.127497282C>T LRSAM1(NM_138361.5):c.1860C>T (p.H620=) - LRSAM1_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1860C>T r.(?) p.(His620=) Unknown - likely benign g.130259561C>T g.127497282C>T LRSAM1(NM_138361.5):c.1860C>T (p.H620=) - LRSAM1_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1912+5A>C r.spl? p.? Unknown - benign g.130259618A>C g.127497339A>C LRSAM1(NM_138361.5):c.1912+5A>C - LRSAM1_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-/. - c.1912+5A>C r.spl? p.? Unknown - benign g.130259618A>C g.127497339A>C LRSAM1(NM_138361.5):c.1912+5A>C - LRSAM1_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
+/. - c.1913-1G>A r.1913_1914del p.Glu638Alafs*7 Both (homozygous) - pathogenic (recessive) g.130263288G>A g.127501009G>A - - LRSAM1_000016 gene localized by homozygosity mapping PubMed: Guernsey 2010 - - Germline yes - - 0 - DNA, RNA arraySNP, RT-PCR, SEQ - - CMT 20865121-Fam PubMed: Guernsey 2010 6-generation family, 7 affected (F, 6m), unaffected heterozygous carrier parents/relatives F;M yes Canada Canadian, rural eastern - 0 - - 7 Johan den Dunnen
+?/. - c.1913_1914del r.(?) p.(Glu638Alafs*7) Both (homozygous) ACMG pathogenic (recessive) g.130263289_130263290del g.127501010_127501011del - - LRSAM1_000054 submission for publication Reilich et al, 2020 (submitted) - - - Germline ? - - 0 - DNA SEQ-NG-I - - CMT-2P - - submission for publication Reilich et al, 2020 (submitted) ? ? ? (unknown) - - 0 - - 1 Andreas Laner
+?/. - c.1957dup r.(?) p.(Gln653Profs*5) Unknown ACMG likely pathogenic g.130263333dup g.127501054dup - - LRSAM1_000015 ACMG grading: PM2,PVS1 - - rs775965001 Germline - - - 0 - DNA SEQ-NG - - - - - - M - Germany - - 0 - - 1 Andreas Laner
+?/. - c.1957dup r.(?) p.(Gln653Profs*5) Unknown ACMG likely pathogenic g.130263328dup g.127501054dup - - LRSAM1_000049 ACMG grading: PVS1,PM2 - - rs775965001 Germline - - - 0 - DNA SEQ-NG-S - - ? - - - M - - - - 0 - - 1 Andreas Laner
-?/. - c.1974T>C r.(?) p.(Ser658=) Unknown - likely benign g.130263350T>C g.127501071T>C LRSAM1(NM_138361.5):c.1974T>C (p.S658=) - FAM129B_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-/. - c.1975G>A r.(?) p.(Val659Met) Unknown - benign g.130263351G>A - LRSAM1(NM_138361.5):c.1975G>A (p.V659M) - FAM129B_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.2011C>T r.(?) p.(Gln671*) Unknown - likely pathogenic g.130263387C>T g.127501108C>T - - LRSAM1_000051 - - - rs876661247 Germline - - - 0 - DNA SEQ-NG-S - - ? - - - M - - - - 0 - - 1 Andreas Laner
+?/. - c.2011del r.(?) p.(Gln671Argfs*15) Unknown ACMG likely pathogenic g.130263387del g.127501108del 2011delC - LRSAM1_000050 ACMG grading: PVS1,PM2 - - - Germline - - - 0 - DNA SEQ-NG-S - - ? - - - F - - - - 0 - - 1 Andreas Laner
+?/. - c.2011del r.(?) p.(Gln671Argfs*15) Unknown ACMG likely pathogenic g.130263387del g.127501108del 2011delC - LRSAM1_000050 ACMG grading: PVS1,PM2 - - - Germline - - - 0 - DNA SEQ-NG-S - - ? - - - F - - - - 0 - - 1 Andreas Laner
+/. - c.2021_2024del r.(?) p.(Glu674Valfs*11) Parent #1 - pathogenic (dominant) g.130263397_130263400del g.127501118_127501121del - - LRSAM1_000019 - PubMed: Zhao 2018 - - Germline yes - - 0 - DNA SEQ - - CMT 29341362-Fam PubMed: Zhao 2018 4-generation family, 6 affected heterozygous carriers (F, 5M) F;M no China - - 0 - - 6 Johan den Dunnen
+?/. - c.2033G>A r.(?) p.(Cys678Tyr) Unknown - likely pathogenic g.130263409G>A g.127501130G>A - - LRSAM1_000023 - - - - Unknown - - - 0 - DNA SEQ - - ? - - - F - - - - 0 - - 1 IMGAG
+?/. - c.2038del r.(?) p.(Glu680AsnfsTer6) Unknown ACMG likely pathogenic g.130263414del g.127501135del - - LRSAM1_000038 ACMG: PVS1,PM2 - - - Germline - - - 0 - DNA SEQ-NG-S - - ? - - - F - - - - 0 - - 1 Andreas Laner
+?/. - c.2038del r.(?) p.(Glu680Asnfs*6) Unknown ACMG likely pathogenic (dominant) g.130263414del g.127501135del 2038delG - LRSAM1_000038 submission for publication Reilich et al, 2020 (submitted) - - - Germline ? - - 0 - DNA SEQ-NG-I - - CMT-2P 105556 - submission for publication Reilich et al, 2020 (submitted) F ? ? (unknown) - - 0 - - 1 Andreas Laner
+/. 24i c.2046+1G>T r.2046_2047ins[u;2046+2_2046+63] p.Glu682_Ala683ins21 Parent #1 - pathogenic (dominant) g.130263423G>T g.127501144G>T - - LRSAM1_000021 - PubMed: Engeholm 2014 - - Germline yes - - 0 - DNA, RNA RT-PCR, SEQ - - CMT 24894446-Fam PubMed: Engeholm 2014 4-generation family, 3 affected heterozygous carriers (2F, M) F;M no Germany - - 0 - - 3 Johan den Dunnen
-/. - c.2046+16T>C r.(=) p.(=) Unknown - benign g.130263438T>C g.127501159T>C LRSAM1(NM_138361.5):c.2046+16T>C - FAM129B_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. 24i c.2047-1G>A r.2047del p.Ala683Profs*3 Parent #1 - pathogenic (dominant) g.130265052G>A g.127502773G>A - - LRSAM1_000017 - PubMed: Nicolaou 2013 - - Germline yes - - 0 - DNA, RNA arraySNP, RT-PCR, SEQ - - CMT 22781092 PubMed: Nicolaou 2013 6-generation family, 22 affected heterozygous carriers (10F, 12M) F;M - Italy Sardian - 0 - - 22 Johan den Dunnen
+/. - c.2047-1G>A r.(?) p.? Parent #1 - pathogenic g.130265052G>A g.127502773G>A - - LRSAM1_000017 - PubMed: Dohrn 2017, Journal: Dohrn 2017 - - Germline - 1/612 cases - 0 - DNA SEQ, SEQ-NG - targeted multigene panel CMT 28902413-Pat11 PubMed: Dohrn 2017, Journal: Dohrn 2017 analysis 612 patients F - (Germany) - - 0 - - 1 Johan den Dunnen
+?/. - c.2047-1G>A r.spl p.? Unknown ACMG likely pathogenic (dominant) g.130265052G>A g.127502773G>A c.2047-1G>A, (p.Ala683Profs*3); Nicolaou, et al., 2013; Dohrn, et al., 2017 - LRSAM1_000017 submission for publication Reilich et al, 2020 (submitted) - - - Germline ? - - 0 - DNA SEQ-NG-I - - CMT-2P - - submission for publication Reilich et al, 2020 (submitted) ? ? ? (unknown) - - 0 - - 1 Andreas Laner
+?/. - c.(2046+1_2047-1)_(*1_?)del r.? p.? Unknown ACMG likely pathogenic (dominant) g.(130263423_130265052)_(130265179_?)del g.(127501144_127502773)_(127502900_?)del deletion Ex25; Mortreux, et al., 2019 - LRSAM1_000056 submission for publication Reilich et al, 2020 (submitted); Truncated protein without RING domain - - - Germline ? - - 0 - DNA SEQ-NG-I - - CMT-2P - submission for publication Reilich et al, 2020 (submitted) - ? ? ? (unknown) - - 0 - - 1 Andreas Laner
?/. - c.2054T>G r.(?) p.(Met685Arg) Unknown - VUS g.130265060T>G g.127502781T>G LRSAM1(NM_138361.5):c.2054T>G (p.M685R) - LRSAM1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.2054T>G r.(?) p.(Met685Arg) Unknown - VUS g.130265060T>G g.127502781T>G LRSAM1(NM_138361.5):c.2054T>G (p.M685R) - LRSAM1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.2054T>G r.(?) p.(Met685Arg) Unknown - pathogenic g.130265060T>G g.127502781T>G LRSAM1(NM_138361.5):c.2054T>G (p.M685R) - LRSAM1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2068T>C r.(?) p.(Cys690Arg) Unknown ACMG VUS g.130265074T>C g.127502795T>C - - LRSAM1_000052 ACMG grading: PM2,PP3 - - rs879253755 Germline - - - 0 - DNA SEQ-NG-S - - ? - - - M - - - - 0 - - 1 Andreas Laner
+?/. - c.2068T>C r.(?) p.(Cys690Arg) Unknown ACMG likely pathogenic (dominant) g.130265074T>C g.127502795T>C - - LRSAM1_000052 submission for publication Reilich et al, 2020 (submitted) - - - Germline ? - - 0 - DNA SEQ-NG-I - - CMT-2P - - submission for publication Reilich et al, 2020 (submitted) ? ? ? (unknown) - - 0 - - 1 Andreas Laner
+?/. - c.2074C>A r.(?) p.(His692Asn) Unknown ACMG likely pathogenic (dominant) g.130265080C>A g.127502801C>A - - LRSAM1_000055 submission for publication Reilich et al, 2020 (submitted); amino acid change from histidine to asparagine, therefore RING domain 675-710 altered at aa 692 - - - Germline ? - - 0 - DNA SEQ-NG-I - - CMT-2P 140851 submission for publication Reilich et al, 2020 (submitted) - M ? Germany - - 0 - - 1 Andreas Laner
./. - c.2075_2087del r.(?) p.(His692Profs*39) Maternal (confirmed) ACMG likely pathogenic g.130265081_130265093del g.127502802_127502814del - - LRSAM1_000001 - PubMed: Trujillano 2017 - - Germline - - - 0 - DNA SEQ, SEQ-NG - - CMT-2P - PubMed: Trujillano 2017 unaffected heterozygous carrier mother, father not available - - - - - 0 - - 1 Daniel Trujillano
+/. - c.2080T>C r.(?) p.(Cys694Arg) Parent #1 - pathogenic (dominant) g.130265086T>C g.127502807T>C - - LRSAM1_000020 tested variant in vitro PubMed: Hu 2016 - - Germline yes - - 0 - DNA SEQ, SEQ-NG - targeted gene panel CMT 27615052_Fam PubMed: Hu 2016 4-generation family, 8 affected heterozygous carriers (4F, 4M) F;M no United States - - 0 - - 8 Johan den Dunnen
+/. 25 c.2081G>A r.(?) p.(Cys694Tyr) Unknown - pathogenic (dominant) g.130265087G>A g.127502808G>A - - LRSAM1_000018 - PubMed: Peeters 2016 - - Germline yes - - 0 - DNA SEQ, SEQ-NG - WGS CMT 27686364-Fam PubMed: Peeters 2016 2-generation family, 13 affected heterozygous carriers (6F, 7M) F;M no Spain - - 0 - - 13 Johan den Dunnen
?/. - c.2087G>C r.(?) p.(Cys696Ser) Unknown - VUS g.130265093G>C g.127502814G>C LRSAM1(NM_138361.5):c.2087G>C (p.C696S) - FAM129B_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+?/. - c.2088C>G r.(?) p.(Cys696Trp) Unknown - likely pathogenic g.130265094C>G g.127502815C>G LRSAM1(NM_138361.5):c.2088C>G (p.C696W) - FAM129B_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.2090A>G r.(?) p.(Gln697Arg) Unknown - VUS g.130265096A>G g.127502817A>G - - LRSAM1_000053 - - - - Germline - - - 0 - DNA SEQ-NG-S - - ? - - - F - - - - 0 - - 1 Andreas Laner
?/. - c.2104_2133dup r.(?) p.(Pro702_Gln711dup) Unknown - VUS g.130265110_130265139dup g.127502831_127502860dup LRSAM1(NM_138361.5):c.2104_2133dupCCACTGCGCACCTGCCCGCTGTGCCGCCAG (p.P702_Q711dup) - FAM129B_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
+/. - c.2121_2122dup r.(?) p.(Leu708Argfs*28) Parent #1 - pathogenic (dominant) g.130265127_130265128dup g.127502848_127502849dup 2121_2122insGC (Leu708Argfx28) - LRSAM1_000009 gene mapped using linkage (LOD score 5.12); variant not in 676 control chromosomes PubMed: Weterman 2012 - - Germline yes - - 0 - DNA arraySNP, SEQ, SEQ-NG - - CMT 22012984-Fam PubMed: Weterman 2012, PubMed: Aerts 2015 3-generation family, 11 affected (5F, 6M) heterozygous carriers F;M no Netherlands - - 0 - - 11 Johan den Dunnen
-/. - c.2157C>T r.(?) p.(Ile719=) Unknown - benign g.130265163C>T g.127502884C>T LRSAM1(NM_138361.5):c.2157C>T (p.I719=) - FAM129B_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query