chloride intracellular channel 2 (CLIC2) - coding DNA reference sequence

(used for variant description)

(last modified February 10, 2020)


This file was created to facilitate the description of sequence variants on transcript NM_001289.4 in the CLIC2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012497.2, covering CLIC2 transcript NM_001289.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5010
                                                   atttaaatgt       c.-241

 .         .         .         .         .         .                g.5070
 tagatcacgaggaagaaggaaaacgatttcaagagctgcacttaagcatctagaattttc       c.-181

 .         .         .         .         .         .                g.5130
 tgcgtcacacctcttgagagaagagactggctccaggtctgactcagtccactacaagct       c.-121

 .         .         .         .         .         .                g.5190
 agacggtcttcttaaagcaccaacattacttgagtctttggataaaattgagaaaagagt       c.-61

 .         .         .         .         .         .                g.5250
 ctacaagtattgtggactctacaggaggcaggaggctgacaactggcagtaaagacaaag       c.-1

          .         .         .         .         .        | 02.    g.40531
 ATGTCAGGCCTGCGGCCCGGCACTCAAGTGGACCCTGAGATTGAGCTTTTTGTAAAG | GCT    c.60
 M  S  G  L  R  P  G  T  Q  V  D  P  E  I  E  L  F  V  K   | A      p.20

          .         .         .         .         .         .       g.40591
 GGAAGTGATGGAGAGAGTATTGGAAACTGTCCCTTTTGCCAACGCCTTTTCATGATCCTC       c.120
 G  S  D  G  E  S  I  G  N  C  P  F  C  Q  R  L  F  M  I  L         p.40

          .         .         .         .        | 03.         .    g.40776
 TGGCTTAAAGGAGTTAAATTTAATGTGACAACTGTTGACATGACCAG | AAAGCCTGAAGAA    c.180
 W  L  K  G  V  K  F  N  V  T  T  V  D  M  T  R  |  K  P  E  E      p.60

          .         .         .         .         .         .       g.40836
 CTAAAGGACTTAGCCCCAGGTACCAATCCTCCGTTCCTGGTGTATAACAAGGAGTTGAAA       c.240
 L  K  D  L  A  P  G  T  N  P  P  F  L  V  Y  N  K  E  L  K         p.80

          .         .         .         .         .    | 04    .    g.59636
 ACAGACTTCATTAAAATTGAGGAGTTTTTAGAACAAACCCTGGCTCCTCCAAG | GTACCCT    c.300
 T  D  F  I  K  I  E  E  F  L  E  Q  T  L  A  P  P  R  |  Y  P      p.100

          .         .         .         .         .         .       g.59696
 CACCTGAGTCCCAAGTACAAGGAGTCTTTTGATGTGGGCTGTAACCTCTTTGCCAAGTTT       c.360
 H  L  S  P  K  Y  K  E  S  F  D  V  G  C  N  L  F  A  K  F         p.120

          .         .         .         . | 05       .         .    g.60387
 TCTGCATACATTAAGAATACACAAAAGGAGGCAAATAAGA | ATTTTGAAAAATCTCTGCTC    c.420
 S  A  Y  I  K  N  T  Q  K  E  A  N  K  N |   F  E  K  S  L  L      p.140

          .         .         .         .         .         .       g.60447
 AAAGAATTCAAGCGTCTGGATGACTACTTAAACACCCCACTTCTGGATGAAATTGATCCA       c.480
 K  E  F  K  R  L  D  D  Y  L  N  T  P  L  L  D  E  I  D  P         p.160

          .         .         .         .         .         .       g.60507
 GACAGTGCTGAGGAACCCCCAGTTTCCAGAAGACTATTCTTGGATGGGGACCAGCTAACA       c.540
 D  S  A  E  E  P  P  V  S  R  R  L  F  L  D  G  D  Q  L  T         p.180

          .         .         .         .   | 06     .         .    g.61651
 CTGGCTGATTGTAGCTTGTTACCCAAGCTGAACATTATTAAA | GTTGCTGCCAAGAAATAT    c.600
 L  A  D  C  S  L  L  P  K  L  N  I  I  K   | V  A  A  K  K  Y      p.200

          .         .         .         .         .         .       g.61711
 CGTGACTTTGACATTCCAGCAGAATTCTCAGGAGTCTGGCGTTATCTCCACAATGCCTAT       c.660
 R  D  F  D  I  P  A  E  F  S  G  V  W  R  Y  L  H  N  A  Y         p.220

          .         .         .         .         .         .       g.61771
 GCCCGTGAAGAATTTACCCACACGTGTCCTGAAGACAAAGAAATTGAAAATACTTACGCA       c.720
 A  R  E  E  F  T  H  T  C  P  E  D  K  E  I  E  N  T  Y  A         p.240

          .         .                                               g.61795
 AATGTGGCTAAACAGAAGAGTTAG                                           c.744
 N  V  A  K  Q  K  S  X                                             p.247

          .         .         .         .         .         .       g.61855
 gagagctcttacaggagaaaaggctatatttgtgatcagattttacttattgacatatta       c.*60

          .         .         .         .         .         .       g.61915
 gaaaggtttttgcaaataagaatatgaaaaatactgtttcttctatccaactctcttatg       c.*120

          .         .         .         .         .         .       g.61975
 aaaaggaactctgtattttctattagccataaataatctgtccactgtattttacaggtc       c.*180

          .         .         .         .         .         .       g.62035
 ttcatacttttacttaattttctttatctgtatggcaaaccactgcaatcctgaatgaca       c.*240

          .         .         .         .         .         .       g.62095
 tggaaagcatcacaatcttttgccctttgcttgaattcctggaatgcatacatataagct       c.*300

          .         .         .         .         .         .       g.62155
 aaacagatgtctgcagttataaatgtcataagtagaggtacaatctcaccctgctcctta       c.*360

          .         .         .         .         .         .       g.62215
 gaaacatttccatataaatcgctaaaataatttcacatttttgttagtttaatatataca       c.*420

          .         .         .         .         .         .       g.62275
 tgagtttatttctgatataaataataaatacagagagtgagcatatcagagaggcaaatt       c.*480

          .         .         .         .         .         .       g.62335
 cttaaagaatgatttttaaaatcagctctaggaagagctcaagatcaattggtcatagaa       c.*540

          .         .         .         .         .         .       g.62395
 cagcatttgacgcctagaactatgaccacctcatggtcagagatgagaatgtagcctttg       c.*600

          .         .         .         .         .         .       g.62455
 tgaccagattatattatttttaaatgaagaagcactcattaaataaaacataattttaaa       c.*660

          .         .         .         .         .         .       g.62515
 aaacaatataagaaacaaagtcaactgaatcttttattcatagaaatgaaaaggaaaata       c.*720

          .         .         .         .         .         .       g.62575
 aaaactgtggctgaccaaaaggtcttcttgttgtccataaaaggataaggtaaacagtcc       c.*780

          .         .         .         .         .         .       g.62635
 ttagataattacaaaactttctacaaaagttaaaatgttacattactatacgtattcaga       c.*840

          .         .         .         .         .         .       g.62695
 ttcacttgttaaagtactcttaaatcattcaaatctggaaacaaaagctgaacttaactc       c.*900

          .         .         .         .         .         .       g.62755
 ttgctccctcaaaagagaaacacaagcataagtgcagcttcaaaaaaggaaaatatttta       c.*960

          .         .         .         .         .         .       g.62815
 ggctttggtggaagggtggagtttagataaaatttaaatgaagtagcgttttaataggtt       c.*1020

          .         .         .         .         .         .       g.62875
 caaagaaaagtaaggcaatgagcaaactcaaagtactgtccttgaaaaccatagagtcaa       c.*1080

          .         .         .         .         .         .       g.62935
 gataaatgtatagtgtatggttaggtggcagagaaatgcaatcatgttgataatctttga       c.*1140

          .         .         .         .         .         .       g.62995
 gatacatcctgtcatcagtatatttcagaatacatgcaatgcactagcaagttacaattg       c.*1200

          .         .         .         .         .         .       g.63055
 atagaatacatttgaaatgttaaatgaaataagccaggcacagaaagacaaacaccacat       c.*1260

          .         .         .         .         .         .       g.63115
 gatctcactcatatgtggaattttaaaaagttgatctcactcatatgtggaattttaaaa       c.*1320

          .         .         .         .         .         .       g.63175
 agttgatctcacacaagtagagggtagaatcgtggttaccaggggctagggagagaaaga       c.*1380

          .         .         .         .         .         .       g.63235
 aggcagaggcactgaaagatgttggtcaatgggtataaagttacacctaggaagaataaa       c.*1440

          .         .         .         .         .         .       g.63295
 ttttggtattcaccacagtagggtgactatagcaaataataatgtagcatgtatttcaag       c.*1500

          .         .         .         .         .         .       g.63355
 atagctagaaaagcaggtttttaaatgtcaccacaaagaaataacaaatgtttatagtgg       c.*1560

          .         .         .         .         .         .       g.63415
 tggatatggtaattacgcctatttgatcattatactgtgtgtacatgcattgaaacacca       c.*1620

          .         .         .         .         .         .       g.63475
 cattgtatcccatatatatgtacaattatgtgcccattatacatttaaaaaataaatttt       c.*1680

          .                                                         g.63487
 aaaaaccttcaa                                                       c.*1692

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Chloride intracellular channel 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 22
©2004-2020 Leiden University Medical Center