troponin C type 1 (slow) (TNNC1) - coding DNA reference sequence

(used for variant description)

(last modified January 27, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_003280.2 in the TNNC1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008963.1, covering TNNC1 transcript NM_003280.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5026
                                   agcaagctgtcctgtgagccgccagc       c.-1

          .         .     | 02   .         .         .      | 03  . g.6794
 ATGGATGACATCTACAAGGCTGCG | GTAGAGCAGCTGACAGAAGAGCAGAAAAATG | AGTTC c.60
 M  D  D  I  Y  K  A  A   | V  E  Q  L  T  E  E  Q  K  N  E |   F   p.20

          .         .         .         .         .         .       g.6854
 AAGGCAGCCTTCGACATCTTCGTGCTGGGCGCTGAGGATGGCTGCATCAGCACCAAGGAG       c.120
 K  A  A  F  D  I  F  V  L  G  A  E  D  G  C  I  S  T  K  E         p.40

          .         .         .         .         .         .       g.6914
 CTGGGCAAGGTGATGAGGATGCTGGGCCAGAACCCCACCCCTGAGGAGCTGCAGGAGATG       c.180
 L  G  K  V  M  R  M  L  G  Q  N  P  T  P  E  E  L  Q  E  M         p.60

          .         .   | 04     .         .         .         .    g.7221
 ATCGATGAGGTGGACGAGGACG | GCAGCGGCACGGTGGACTTTGATGAGTTCCTGGTCATG    c.240
 I  D  E  V  D  E  D  G |   S  G  T  V  D  F  D  E  F  L  V  M      p.80

          .         .         .         .         .         .       g.7281
 ATGGTTCGGTGCATGAAGGACGACAGCAAAGGGAAATCTGAGGAGGAGCTGTCTGACCTC       c.300
 M  V  R  C  M  K  D  D  S  K  G  K  S  E  E  E  L  S  D  L         p.100

          .        | 05.         .         .         .         .    g.7557
 TTCCGCATGTTTGACAA | AAATGCTGATGGCTACATCGACCTGGATGAGCTGAAGATAATG    c.360
 F  R  M  F  D  K  |  N  A  D  G  Y  I  D  L  D  E  L  K  I  M      p.120

          .         .         .         .         .         .       g.7617
 CTGCAGGCTACAGGCGAGACCATCACGGAGGACGACATCGAGGAGCTCATGAAGGACGGA       c.420
 L  Q  A  T  G  E  T  I  T  E  D  D  I  E  E  L  M  K  D  G         p.140

          .         .         .     | 06   .         .         .    g.7761
 GACAAGAACAACGACGGCCGCATCGACTATGATG | AGTTCCTGGAGTTCATGAAGGGTGTG    c.480
 D  K  N  N  D  G  R  I  D  Y  D  E |   F  L  E  F  M  K  G  V      p.160

                                                                    g.7767
 GAGTAG                                                             c.486
 E  X                                                               p.161

          .         .         .         .         .         .       g.7827
 atgctgaccttcacccagagctgcctatgcccagcctccaactccagctgagtcctgggg       c.*60

          .         .         .         .         .         .       g.7887
 ttggggagggggtcggggtcccaggacctgagcctggccatgtcctcaaccccaaatccc       c.*120

          .         .         .         .         .         .       g.7947
 ccgactccctccccagatctgtcctgggggatgcaaataaagcctgctctcccaaggtct       c.*180

                                                                    g.7951
 gcta                                                               c.*184

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Troponin C type 1 (slow) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 14c
©2004-2016 Leiden University Medical Center