ADP-ribosylation factor-like 13B (ARL13B) - coding DNA reference sequence

(used for variant description)

(last modified June 21, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_182896.2 in the ARL13B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_017076.1, covering ARL13B transcript NM_182896.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5045
                agcacgtcgacgcggggcttttctttagccgggtcccgctaactc       c.-241

 .         .         .         .         .         .                g.5105
 ggctacggtgtatctgcgtctttggtcaggttgttccttggctaagagggcagtcgtcgc       c.-181

 .         .         .         .         .         .                g.5165
 ggacccacgcggttagcaaggcttagtgctcgggccggccgccttcacttccctcccggc       c.-121

 .         .         .         .         .         .                g.5225
 ttttcctcccgacttatccactttaggggcgtctcggagtgccggaggcccccggggaag       c.-61

 .         .         .         .         .         .                g.5285
 agcggggtgccggtgtccgctccgggctcggatgggaagtggtgggaggagcgacccggg       c.-1

          .         .         .         .         .          | 02    g.20736
 ATGTTCAGTCTGATGGCCAGTTGCTGCGGCTGGTTCAAGCGGTGGCGGGAGCCTGTCAG | A    c.60
 M  F  S  L  M  A  S  C  C  G  W  F  K  R  W  R  E  P  V  R  |      p.20

          .         .         .         .         .         .       g.20796
 AAGGTGACTCTTTTGATGGTGGGACTTGATAATGCTGGTAAAACCGCAACAGCAAAGGGA       c.120
 K  V  T  L  L  M  V  G  L  D  N  A  G  K  T  A  T  A  K  G         p.40

          . | 03       .         .         .         .         .    g.28570
 ATCCAAGGAG | AATACCCTGAAGATGTAGCTCCTACTGTTGGATTTTCAAAAATTAACCTT    c.180
 I  Q  G  E |   Y  P  E  D  V  A  P  T  V  G  F  S  K  I  N  L      p.60

          .         .         .         .         .         .       g.28630
 AGACAAGGAAAGTTTGAAGTCACCATCTTTGACTTGGGAGGTGGAATAAGAATTCGGGGA       c.240
 R  Q  G  K  F  E  V  T  I  F  D  L  G  G  G  I  R  I  R  G         p.80

          .         .         .         .         .         .       g.28690
 ATCTGGAAGAATTACTATGCTGAATCCTATGGGGTAATATTTGTTGTGGATTCCAGTGAT       c.300
 I  W  K  N  Y  Y  A  E  S  Y  G  V  I  F  V  V  D  S  S  D         p.100

          .         .         .         .         .         .       g.28750
 GAAGAGAGAATGGAAGAGACAAAAGAGGCTATGTCAGAAATGCTAAGACATCCTAGGATA       c.360
 E  E  R  M  E  E  T  K  E  A  M  S  E  M  L  R  H  P  R  I         p.120

          .         . | 04       .         .         .         .    g.60232
 TCGGGAAAGCCTATATTGGT | GTTGGCAAATAAACAAGATAAAGAAGGAGCTTTAGGAGAA    c.420
 S  G  K  P  I  L  V  |  L  A  N  K  Q  D  K  E  G  A  L  G  E      p.140

          .         .         .         .         .         .       g.60292
 GCTGATGTCATTGAATGTCTATCTCTGGAAAAATTGGTCAATGAGCACAAGTGCCTGTGT       c.480
 A  D  V  I  E  C  L  S  L  E  K  L  V  N  E  H  K  C  L  C         p.160

        | 05 .         .         .         .         .         .    g.61467
 CAGATA | GAACCATGTTCAGCAATCTCGGGGTATGGAAAGAAAATTGACAAGTCCATTAAA    c.540
 Q  I   | E  P  C  S  A  I  S  G  Y  G  K  K  I  D  K  S  I  K      p.180

          .         .         .         .         .         .       g.61527
 AAAGGCCTTTATTGGCTGCTACATGTTATTGCAAGAGACTTTGATGCCTTAAATGAACGC       c.600
 K  G  L  Y  W  L  L  H  V  I  A  R  D  F  D  A  L  N  E  R         p.200

          .         .         .         .         .         .       g.61587
 ATCCAAAAAGAGACAACAGAGCAGCGTGCTCTTGAGGAACAAGAGAAACAAGAAAGAGCT       c.660
 I  Q  K  E  T  T  E  Q  R  A  L  E  E  Q  E  K  Q  E  R  A         p.220

          .         .          | 06        .         .         .    g.64772
 GAACGAGTGCGAAAATTACGAGAAGAAAG | AAAACAAAATGAACAGGAGCAGGCTGAACTC    c.720
 E  R  V  R  K  L  R  E  E  R  |  K  Q  N  E  Q  E  Q  A  E  L      p.240

          .         .         .         .         .         .       g.64832
 GATGGAACCAGTGGTCTGGCTGAGTTGGACCCAGAACCAACGAATCCTTTCCAGCCAATA       c.780
 D  G  T  S  G  L  A  E  L  D  P  E  P  T  N  P  F  Q  P  I         p.260

          .         | 07         .         .         .         .    g.67918
 GCATCTGTAATCATTGAG | AATGAAGGAAAACTTGAAAGAGAGAAAAAAAACCAAAAAATG    c.840
 A  S  V  I  I  E   | N  E  G  K  L  E  R  E  K  K  N  Q  K  M      p.280

          .         .         .         .         .         .       g.67978
 GAGAAAGACAGTGATGGCTGCCACCTGAAACATAAAATGGAGCATGAGCAAATAGAGACA       c.900
 E  K  D  S  D  G  C  H  L  K  H  K  M  E  H  E  Q  I  E  T         p.300

          .         .         .         .         .         .       g.68038
 CAAGGCCAGGTTAATCACAATGGCCAAAAAAATAATGAATTTGGACTAGTAGAAAATTAT       c.960
 Q  G  Q  V  N  H  N  G  Q  K  N  N  E  F  G  L  V  E  N  Y         p.320

          .         .         .         .         .         .       g.68098
 AAGGAGGCATTAACACAGCAGTTAAAGAATGAAGATGAGACAGACCGGCCATCATTGGAA       c.1020
 K  E  A  L  T  Q  Q  L  K  N  E  D  E  T  D  R  P  S  L  E         p.340

      | 08   .         .         .         .         .         .    g.74323
 TCAG | CTAATGGTAAAAAGAAAACTAAGAAACTAAGAATGAAAAGGAACCACCGGGTAGAA    c.1080
 S  A |   N  G  K  K  K  T  K  K  L  R  M  K  R  N  H  R  V  E      p.360

          .         .         .         .         .         .       g.74383
 CCACTTAATATAGATGACTGTGCTCCTGAGAGTCCAACGCCACCCCCACCCCCTCCTCCT       c.1140
 P  L  N  I  D  D  C  A  P  E  S  P  T  P  P  P  P  P  P  P         p.380

   | 09      .         .         .         .         .         .    g.75744
 G | TTGGCTGGGGAACCCCTAAAGTCACTAGACTTCCAAAACTTGAGCCTCTTGGTGAAACA    c.1200
 V |   G  W  G  T  P  K  V  T  R  L  P  K  L  E  P  L  G  E  T      p.400

          . | 10       .         .         .         .         .    g.78098
 CATCATAATG | ATTTCTATAGGAAGCCACTGCCTCCCCTGGCTGTGCCACAGCGACCTAAC    c.1260
 H  H  N  D |   F  Y  R  K  P  L  P  P  L  A  V  P  Q  R  P  N      p.420

          .         .                                               g.78125
 AGTGATGCTCATGATGTGATCTCATAA                                        c.1287
 S  D  A  H  D  V  I  S  X                                          p.428

          .         .         .        | 11.         .         .    g.78341
 acaagacgtatggaggagttctcttaatatcagcaag | aagcacaatgaccagtacatgaa    c.*60

          .         .         .         .         .         .       g.78401
 atcagcatttggaccaaattagcaagatttactgttgactctggtttatacatccccact       c.*120

          .         .         .         .         .         .       g.78461
 catgagcatacttctgaaggaaaactttacaaaaagagccaatggactcagcactttctt       c.*180

          .         .         .         .         .         .       g.78521
 tactatttgttcaatagcctatatttctagatattaaatattttttgtaagatatatgca       c.*240

          .         .         .         .         .         .       g.78581
 catagaagggggacttctaggaatttataaccaaaattttaaaactatttttatattttt       c.*300

          .         .         .         .         .         .       g.78641
 ttaaatctttaaaaattttaattactgtgatattgattatacaccttttttatagatgat       c.*360

          .         .         .         .         .         .       g.78701
 ttgtttaaattatatctggaaaatagagttgatttactttcagacatgaactatacaaac       c.*420

          .         .         .         .         .         .       g.78761
 aggatatatttatatggcttgaggtatgttttgtaatagcgttgttctttaagtgtacat       c.*480

          .         .         .         .         .         .       g.78821
 cgtaatttgacctaatttaaaaataatatattttcgaagtagtagattctcagatcttta       c.*540

          .         .         .         .         .         .       g.78881
 ttctaacaattacatgatttgaaaacagtactcaatgagactggaaataccttttgtacc       c.*600

          .         .         .         .         .         .       g.78941
 taaatgttttttaaattaatcaaaatacattctgtgagatactattaaaagtctcagtaa       c.*660

          .         .         .         .         .         .       g.79001
 agtcctattttaaaggttagacactttcagagatcaaggtgctccctatactcccttgtt       c.*720

          .         .         .         .         .         .       g.79061
 ccatcagaagctgcagtgactcttttaggtgattctaattctttcatgccttgaaattaa       c.*780

          .         .         .         .         .         .       g.79121
 actatgaaattaaaggcagaaaaactggaaaacctactgcaggtccagagacttctgttt       c.*840

          .         .         .         .         .         .       g.79181
 tacaactgggaaacagcttgtgtactaaagtaatgagaataaaaatgttggcccaaaatt       c.*900

          .         .         .         .         .         .       g.79241
 acttttataaataaataattccaaaataatttcttaatttaaaatgatagcacttctctt       c.*960

          .         .         .         .         .         .       g.79301
 gcacttaagaatggcatccataagattctgtatttggcatttagactaacttctagatgt       c.*1020

          .         .         .         .         .         .       g.79361
 atatttttaataatagattcataatgttacatttaattgaaaacaaacctttatatccaa       c.*1080

          .         .         .         .         .         .       g.79421
 tgaaaatagtataaacagaatgatttttataccaccttgttaagattggtgcttttggta       c.*1140

          .         .         .         .         .         .       g.79481
 acttgtactgacacaacagacatgtgctagtatctgataacattaagtacattttatgtc       c.*1200

          .         .         .         .         .         .       g.79541
 gtttaatataattatttactttaaaaattgtacttcagaacatcagattttattcacatt       c.*1260

          .         .         .         .         .         .       g.79601
 ttttaactcactgaactttaataatcaggtcacctgtactctagtcagcactgtatatat       c.*1320

          .         .         .         .         .         .       g.79661
 tcttggagtttgtacatgggacttagcaaccacactgagtgaggtaaaagcatttgattt       c.*1380

          .         .         .         .         .         .       g.79721
 cagatctaaaattcgtaacaacctaaatttgagaggtggctgaaatgtgatgaaaagcaa       c.*1440

          .         .         .         .         .         .       g.79781
 tacgaaaagacaatgtaaactttgaaaaggattttagagggaaaattgcatagctttttg       c.*1500

          .         .         .         .         .         .       g.79841
 taacatttacttaattttaaaactaaactcatacttttgctatctttttaatatttatct       c.*1560

          .         .         .         .         .         .       g.79901
 cgtttgggagtatacgtgtttttaaaatttgtgttttctatctgtttactatagtgtagc       c.*1620

          .         .         .         .         .         .       g.79961
 tactggcttcatttaataaaaataaatgattttgaaattaaatataatatagaattcaca       c.*1680

          .         .         .         .         .         .       g.80021
 ttttatatagctctctcaaaaattaatttttattccttaagcattttaaaaacattttaa       c.*1740

          .         .         .         .         .         .       g.80081
 aaaatgttttgtaaatccaggtgtattttaacaattaaatgcctattttgttatatgtta       c.*1800

          .         .         .         .         .         .       g.80141
 tacttttattcttaattctgaattttgacattttcacacaataaaaataatttatatcaa       c.*1860

          .         .         .         .         .         .       g.80201
 tattctgtttctcttttcaattggtagatttaaatgatttcctttgggtaataaaatagg       c.*1920

          .         .         .         .         .         .       g.80261
 taaagattttaaaatatgattattgaaaaacagtttaaatcagtagattaaaataatgca       c.*1980

          .         .         .         .         .         .       g.80321
 tttttttgatactttacacacaaaacttttttctctctgcaagtttttatgtatgtggga       c.*2040

          .         .         .         .         .         .       g.80381
 aagaatttgtgattttaaatgcagctacaaatagcatttcaccatatgatgttagaggat       c.*2100

          .         .         .         .         .         .       g.80441
 ttgatgtctgtcttgcgttaaagctgttggtcaacagatatgtttttatgtatttaaaag       c.*2160

          .         .         .         .         .         .       g.80501
 aggctcttgtgtgcctttatgtgtaaaatgcatattacgtagtatacatgatattgtatg       c.*2220

          .         .         .                                     g.80540
 taactgacttcaaatataaaactatgcatagaaacaaca                            c.*2259

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The ADP-ribosylation factor-like 13B protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center