D-2-hydroxyglutarate dehydrogenase (D2HGDH) - coding DNA reference sequence

(used for variant description)

(last modified November 16, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_152783.3 in the D2HGDH gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012012.1, covering D2HGDH transcript NM_152783.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5053
        ggcgtcgccccgcccactccggctcggcggctctgggcctgcggcgggcgctg       c.-121

 .         .         .        | 02.         .         .             g.5550
 cgggttggagctcgggacgtgatcgtgg | gcgcgcagccagcggctccctgcccttcccct    c.-61

 .         .         .         .         .         .                g.5610
 ccgggccctgagtaccggccccccaccaaggaggagcccgaggtctccgtcccggcggcg       c.-1

          .         .         .         .         .         .       g.5670
 ATGCTGCCCCGTCGGCCTCTGGCGTGGCCCGCGTGGCTGTTGCGGGGTGCTCCGGGAGCC       c.60
 M  L  P  R  R  P  L  A  W  P  A  W  L  L  R  G  A  P  G  A         p.20

          .         .         .         .         .         .       g.5730
 GCGGGTTCTTGGGGTCGGCCGGTTGGCCCCCTGGCCCGCAGAGGCTGCTGCTCCGCCCCG       c.120
 A  G  S  W  G  R  P  V  G  P  L  A  R  R  G  C  C  S  A  P         p.40

          .         .         .         .         .         .       g.5790
 GGGACCCCCGAGGTGCCGCTGACCCGGGAGCGCTACCCCGTGCGGCGCTTGCCGTTCTCC       c.180
 G  T  P  E  V  P  L  T  R  E  R  Y  P  V  R  R  L  P  F  S         p.60

          .         .         .         .         .         .       g.5850
 ACGGTGTCTAAGCAGGACCTGGCCGCCTTTGAGCGCATCGTGCCCGGCGGGGTCGTCACG       c.240
 T  V  S  K  Q  D  L  A  A  F  E  R  I  V  P  G  G  V  V  T         p.80

          .         .         .         .         .   | 03     .    g.11426
 GACCCGGAAGCGCTGCAGGCTCCCAACGTGGACTGGTTGCGGACGCTGCGAG | GCTGTAGC    c.300
 D  P  E  A  L  Q  A  P  N  V  D  W  L  R  T  L  R  G |   C  S      p.100

          .         .         .         .         . | 04       .    g.12830
 AAGGTGCTGCTGAGGCCACGGACGTCGGAGGAGGTGTCCCACATCCTCAG | GCACTGCCAC    c.360
 K  V  L  L  R  P  R  T  S  E  E  V  S  H  I  L  R  |  H  C  H      p.120

          .         .         .         .         .         .       g.12890
 GAGAGGAACCTGGCCGTGAACCCACAGGGGGGCAACACAGGCATGGTGGGTGGCAGCGTC       c.420
 E  R  N  L  A  V  N  P  Q  G  G  N  T  G  M  V  G  G  S  V         p.140

          .         .         .         .         .         .       g.12950
 CCCGTCTTTGACGAGATCATCCTCTCCACTGCCCGCATGAACCGGGTCCTCAGCTTCCAC       c.480
 P  V  F  D  E  I  I  L  S  T  A  R  M  N  R  V  L  S  F  H         p.160

          . | 05       .         .         .         .         .    g.14057
 AGCGTGTCTG | GAATTCTGGTTTGCCAGGCGGGCTGCGTCCTGGAGGAGCTGAGCCGGTAT    c.540
 S  V  S  G |   I  L  V  C  Q  A  G  C  V  L  E  E  L  S  R  Y      p.180

          .         .         .         .         .         .       g.14117
 GTGGAGGAACGGGACTTCATCATGCCGCTGGACTTAGGAGCCAAGGGCAGCTGCCACATC       c.600
 V  E  E  R  D  F  I  M  P  L  D  L  G  A  K  G  S  C  H  I         p.200

          .         .         .         .         .         .       g.14177
 GGGGGAAACGTGGCAACCAACGCTGGAGGCCTGCGGTTTCTTCGATATGGCTCACTGCAT       c.660
 G  G  N  V  A  T  N  A  G  G  L  R  F  L  R  Y  G  S  L  H         p.220

          .         .     | 06   .         .         .         .    g.15130
 GGGACTGTCCTGGGCCTGGAAGTG | GTGCTGGCCGACGGCACTGTCCTGGACTGCCTGACC    c.720
 G  T  V  L  G  L  E  V   | V  L  A  D  G  T  V  L  D  C  L  T      p.240

          .         .         .         .         .         .       g.15190
 TCCCTGAGGAAGGACAACACGGGCTATGACCTGAAGCAGCTGTTCATCGGGTCGGAGGGC       c.780
 S  L  R  K  D  N  T  G  Y  D  L  K  Q  L  F  I  G  S  E  G         p.260

          .         .         .         .         .         .       g.15250
 ACTTTGGGGATCATCACCACGGTGTCCATCTTGTGTCCACCCAAGCCCAGGGCTGTGAAC       c.840
 T  L  G  I  I  T  T  V  S  I  L  C  P  P  K  P  R  A  V  N         p.280

          .    | 07    .         .         .         .         .    g.20583
 GTGGCTTTCCTCG | GCTGCCCAGGCTTTGCTGAGGTTCTGCAGACCTTCAGCACCTGCAAG    c.900
 V  A  F  L  G |   C  P  G  F  A  E  V  L  Q  T  F  S  T  C  K      p.300

          .         .         .         .         .         .       g.20643
 GGGATGCTGGGTGAGATCCTGTCTGCATTCGAGTTCATGGATGCTGTGTGCATGCAGCTG       c.960
 G  M  L  G  E  I  L  S  A  F  E  F  M  D  A  V  C  M  Q  L         p.320

          .         .         .        | 08.         .         .    g.21654
 GTCGGGCGCCATCTCCACCTGGCCAGCCCGGTGCAAG | AGAGTCCGTTTTACGTCCTCATC    c.1020
 V  G  R  H  L  H  L  A  S  P  V  Q  E |   S  P  F  Y  V  L  I      p.340

          .         .         .         .         .         .       g.21714
 GAGACTTCAGGCTCCAACGCAGGCCATGACGCTGAGAAGCTGGGCCACTTCCTGGAGCAC       c.1080
 E  T  S  G  S  N  A  G  H  D  A  E  K  L  G  H  F  L  E  H         p.360

          .         .         .         .         .         .       g.21774
 GCGCTGGGCTCCGGCCTGGTGACCGATGGGACCATGGCCACCGACCAGAGGAAAGTCAAG       c.1140
 A  L  G  S  G  L  V  T  D  G  T  M  A  T  D  Q  R  K  V  K         p.380

  | 09       .         .         .         .         .         .    g.26294
  | ATGCTGTGGGCCCTGAGGGAAAGGATCACAGAGGCGCTGAGCCGGGATGGCTACGTGTAC    c.1200
  | M  L  W  A  L  R  E  R  I  T  E  A  L  S  R  D  G  Y  V  Y      p.400

          .         .         .         .         .         .       g.26354
 AAGTACGACCTCTCCCTCCCTGTGGAGCGGCTCTACGACATCGTGACTGACCTGCGCGCC       c.1260
 K  Y  D  L  S  L  P  V  E  R  L  Y  D  I  V  T  D  L  R  A         p.420

          .         .         .         .       | 10 .         .    g.38109
 CGCCTCGGCCCGCACGCCAAGCACGTGGTGGGCTATGGCCACCTTG | GAGATGGTAACCTG    c.1320
 R  L  G  P  H  A  K  H  V  V  G  Y  G  H  L  G |   D  G  N  L      p.440

          .         .         .         .         .         .       g.38169
 CACCTCAATGTGACGGCGGAGGCCTTCAGCCCCTCGCTCCTGGCTGCCCTGGAGCCCCAC       c.1380
 H  L  N  V  T  A  E  A  F  S  P  S  L  L  A  A  L  E  P  H         p.460

          .         .         .         .         .         .       g.38229
 GTGTACGAGTGGACGGCCGGGCAGCAGGGCAGCGTCAGCGCGGAGCACGGAGTGGGCTTC       c.1440
 V  Y  E  W  T  A  G  Q  Q  G  S  V  S  A  E  H  G  V  G  F         p.480

          .         .         .         .         .         .       g.38289
 AGGAAGAGGGACGTCCTGGGCTACAGCAAGCCACCGGGGGCCCTGCAGCTCATGCAGCAG       c.1500
 R  K  R  D  V  L  G  Y  S  K  P  P  G  A  L  Q  L  M  Q  Q         p.500

          .         .         .         .         .         .       g.38349
 CTCAAGGCCCTGCTGGACCCCAAGGGCATCCTCAACCCCTACAAGACGCTGCCCAGCCAG       c.1560
 L  K  A  L  L  D  P  K  G  I  L  N  P  Y  K  T  L  P  S  Q         p.520

                                                                    g.38355
 GCCTGA                                                             c.1566
 A  X                                                               p.521

          .         .         .         .         .         .       g.38415
 cggccactcctgctgctgccaaggcccactgggggtcggcgggtggctctcgggcggggg       c.*60

          .         .         .         .         .         .       g.38475
 tgttgcggtggctctgagggatgagccggcagtgggcaggggaccaggcacctggttgaa       c.*120

          .         .         .         .         .         .       g.38535
 gggactgggagcccgcactggggaactgccggacgcaggccctcgggcaggagcatctgg       c.*180

          .         .         .         .         .         .       g.38595
 cagagtggggggcgtggcaggcaccctcctttgcagggcgaggtggggcctctgcagcca       c.*240

          .         .         .         .         .         .       g.38655
 tcctggacaggccggggtggcggcagctttgcccacgtggaagcggggtgggtctcactt       c.*300

          .         .         .         .         .         .       g.38715
 gcgtggtggcccctggccccatcttgcctgctgcggcctggggagcaggcgctgggtggt       c.*360

          .         .         .         .         .         .       g.38775
 ggttctgcctgcttgctgctcgttccccgggcatgcgtgggcagcggggggcatgcgtgg       c.*420

          .         .         .         .         .         .       g.38835
 gcagcagggggcgtgggcagcgggggcacgggcaggaccacgtgggccgtgatcgtgggt       c.*480

          .         .         .         .         .         .       g.38895
 tgccgagaggacctgagcgctgcggctctgctgaatggagccgggtccctcaggccgtgg       c.*540

          .         .         .         .         .         .       g.38955
 acgccctcgggaggggggtgactgtggcttgtgtctggacaggaatgtgtcatttcccac       c.*600

          .         .         .         .         .         .       g.39015
 atcttctagagggctgccagctgggaagacagttatcagggcaagctgtgctctgagttt       c.*660

          .         .         .         .         .         .       g.39075
 cgggttctgctcctacaaagaacgtgcggtgctgcgggcgagggccccggcacggacaag       c.*720

          .         .         .         .         .         .       g.39135
 ggccactgcagagtgtgtttctgctcgtcagctgccctgggcagcggatgggctgggcga       c.*780

          .         .         .         .         .         .       g.39195
 tgcagctggatgcacatctcattctgtcatgaatgtccagtaaaaatctgaattggttgc       c.*840

                                                                    g.39202
 aaccttc                                                            c.*847

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The D-2-hydroxyglutarate dehydrogenase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center