mutS homolog 6 (E. coli) (MSH6) - coding DNA reference sequence

(used for variant description)

(last modified August 22, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_000179.2 in the MSH6 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007111.1, covering MSH6 transcript NM_000179.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.4967
                             ggcgaggcgcctgttgattggccactggggcc       c.-121

 .         .         .         .         .         .                g.5027
 cgggttcctccggcggagcgcgcctccccccagatttcccgccagcaggagccgcgcggt       c.-61

 .         .         .         .         .         .                g.5087
 agatgcggtgcttttaggagctccgtccgacagaacggttgggccttgccggctgtcggt       c.-1

          .         .         .         .         .         .       g.5147
 ATGTCGCGACAGAGCACCCTGTACAGCTTCTTCCCCAAGTCTCCGGCGCTGAGTGATGCC       c.60
 M  S  R  Q  S  T  L  Y  S  F  F  P  K  S  P  A  L  S  D  A         p.20

          .         .         .         .         .         .       g.5207
 AACAAGGCCTCGGCCAGGGCCTCACGCGAAGGCGGCCGTGCCGCCGCTGCCCCCGGGGCC       c.120
 N  K  A  S  A  R  A  S  R  E  G  G  R  A  A  A  A  P  G  A         p.40

          .         .         .         .         .         .       g.5267
 TCTCCTTCCCCAGGCGGGGATGCGGCCTGGAGCGAGGCTGGGCCTGGGCCCAGGCCCTTG       c.180
 S  P  S  P  G  G  D  A  A  W  S  E  A  G  P  G  P  R  P  L         p.60

          .         .         .         .         .         .       g.5327
 GCGCGCTCCGCGTCACCGCCCAAGGCGAAGAACCTCAACGGAGGGCTGCGGAGATCGGTA       c.240
 A  R  S  A  S  P  P  K  A  K  N  L  N  G  G  L  R  R  S  V         p.80

          .         . | 02       .         .         .         .    g.12820
 GCGCCTGCTGCCCCCACCAG | TTGTGACTTCTCACCAGGAGATTTGGTTTGGGCCAAGATG    c.300
 A  P  A  A  P  T  S  |  C  D  F  S  P  G  D  L  V  W  A  K  M      p.100

          .         .         .         .         .         .       g.12880
 GAGGGTTACCCCTGGTGGCCTTGTCTGGTTTACAACCACCCCTTTGATGGAACATTCATC       c.360
 E  G  Y  P  W  W  P  C  L  V  Y  N  H  P  F  D  G  T  F  I         p.120

          .         .         .         .         .         .       g.12940
 CGCGAGAAAGGGAAATCAGTCCGTGTTCATGTACAGTTTTTTGATGACAGCCCAACAAGG       c.420
 R  E  K  G  K  S  V  R  V  H  V  Q  F  F  D  D  S  P  T  R         p.140

          .         .         .        | 03.         .         .    g.17770
 GGCTGGGTTAGCAAAAGGCTTTTAAAGCCATATACAG | GTTCAAAATCAAAGGAAGCCCAG    c.480
 G  W  V  S  K  R  L  L  K  P  Y  T  G |   S  K  S  K  E  A  Q      p.160

          .         .         .         .         .         .       g.17830
 AAGGGAGGTCATTTTTACAGTGCAAAGCCTGAAATACTGAGAGCAATGCAACGTGCAGAT       c.540
 K  G  G  H  F  Y  S  A  K  P  E  I  L  R  A  M  Q  R  A  D         p.180

          .         .         .         .         .         .       g.17890
 GAAGCCTTAAATAAAGACAAGATTAAGAGGCTTGAATTGGCAGTTTGTGATGAGCCCTCA       c.600
 E  A  L  N  K  D  K  I  K  R  L  E  L  A  V  C  D  E  P  S         p.200

          .         .        | 04.         .         .         .    g.20497
 GAGCCAGAAGAGGAAGAAGAGATGGAG | GTAGGCACAACTTACGTAACAGATAAGAGTGAA    c.660
 E  P  E  E  E  E  E  M  E   | V  G  T  T  Y  V  T  D  K  S  E      p.220

          .         .         .         .         .         .       g.20557
 GAAGATAATGAAATTGAGAGTGAAGAGGAAGTACAGCCTAAGACACAAGGATCTAGGCGA       c.720
 E  D  N  E  I  E  S  E  E  E  V  Q  P  K  T  Q  G  S  R  R         p.240

          .         .         .         .         .         .       g.20617
 AGTAGCCGCCAAATAAAAAAACGAAGGGTCATATCAGATTCTGAGAGTGACATTGGTGGC       c.780
 S  S  R  Q  I  K  K  R  R  V  I  S  D  S  E  S  D  I  G  G         p.260

          .         .         .         .         .         .       g.20677
 TCTGATGTGGAATTTAAGCCAGACACTAAGGAGGAAGGAAGCAGTGATGAAATAAGCAGT       c.840
 S  D  V  E  F  K  P  D  T  K  E  E  G  S  S  D  E  I  S  S         p.280

          .         .         .         .         .         .       g.20737
 GGAGTGGGGGATAGTGAGAGTGAAGGCCTGAACAGCCCTGTCAAAGTTGCTCGAAAGCGG       c.900
 G  V  G  D  S  E  S  E  G  L  N  S  P  V  K  V  A  R  K  R         p.300

          .         .         .         .         .         .       g.20797
 AAGAGAATGGTGACTGGAAATGGCTCTCTTAAAAGGAAAAGCTCTAGGAAGGAAACGCCC       c.960
 K  R  M  V  T  G  N  G  S  L  K  R  K  S  S  R  K  E  T  P         p.320

          .         .         .         .         .         .       g.20857
 TCAGCCACCAAACAAGCAACTAGCATTTCATCAGAAACCAAGAATACTTTGAGAGCTTTC       c.1020
 S  A  T  K  Q  A  T  S  I  S  S  E  T  K  N  T  L  R  A  F         p.340

          .         .         .         .         .         .       g.20917
 TCTGCCCCTCAAAATTCTGAATCCCAAGCCCACGTTAGTGGAGGTGGTGATGACAGTAGT       c.1080
 S  A  P  Q  N  S  E  S  Q  A  H  V  S  G  G  G  D  D  S  S         p.360

          .         .         .         .         .         .       g.20977
 CGCCCTACTGTTTGGTATCATGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGAT       c.1140
 R  P  T  V  W  Y  H  E  T  L  E  W  L  K  E  E  K  R  R  D         p.380

          .         .         .         .         .         .       g.21037
 GAGCACAGGAGGAGGCCTGATCACCCCGATTTTGATGCATCTACACTCTATGTGCCTGAG       c.1200
 E  H  R  R  R  P  D  H  P  D  F  D  A  S  T  L  Y  V  P  E         p.400

          .         .         .         .         .         .       g.21097
 GATTTCCTCAATTCTTGTACTCCTGGGATGAGGAAGTGGTGGCAGATTAAGTCTCAGAAC       c.1260
 D  F  L  N  S  C  T  P  G  M  R  K  W  W  Q  I  K  S  Q  N         p.420

          .         .         .         .         .         .       g.21157
 TTTGATCTTGTCATCTGTTACAAGGTGGGGAAATTTTATGAGCTGTACCACATGGATGCT       c.1320
 F  D  L  V  I  C  Y  K  V  G  K  F  Y  E  L  Y  H  M  D  A         p.440

          .         .         .         .         .         .       g.21217
 CTTATTGGAGTCAGTGAACTGGGGCTGGTATTCATGAAAGGCAACTGGGCCCATTCTGGC       c.1380
 L  I  G  V  S  E  L  G  L  V  F  M  K  G  N  W  A  H  S  G         p.460

          .         .         .         .         .         .       g.21277
 TTTCCTGAAATTGCATTTGGCCGTTATTCAGATTCCCTGGTGCAGAAGGGCTATAAAGTA       c.1440
 F  P  E  I  A  F  G  R  Y  S  D  S  L  V  Q  K  G  Y  K  V         p.480

          .         .         .         .         .         .       g.21337
 GCACGAGTGGAACAGACTGAGACTCCAGAAATGATGGAGGCACGATGTAGAAAGATGGCA       c.1500
 A  R  V  E  Q  T  E  T  P  E  M  M  E  A  R  C  R  K  M  A         p.500

          .         .         .         .         .         .       g.21397
 CATATATCCAAGTATGATAGAGTGGTGAGGAGGGAGATCTGTAGGATCATTACCAAGGGT       c.1560
 H  I  S  K  Y  D  R  V  V  R  R  E  I  C  R  I  I  T  K  G         p.520

          .         .         .         .         .         .       g.21457
 ACACAGACTTACAGTGTGCTGGAAGGTGATCCCTCTGAGAACTACAGTAAGTATCTTCTT       c.1620
 T  Q  T  Y  S  V  L  E  G  D  P  S  E  N  Y  S  K  Y  L  L         p.540

          .         .         .         .         .         .       g.21517
 AGCCTCAAAGAAAAAGAGGAAGATTCTTCTGGCCATACTCGTGCATATGGTGTGTGCTTT       c.1680
 S  L  K  E  K  E  E  D  S  S  G  H  T  R  A  Y  G  V  C  F         p.560

          .         .         .         .         .         .       g.21577
 GTTGATACTTCACTGGGAAAGTTTTTCATAGGTCAGTTTTCAGATGATCGCCATTGTTCG       c.1740
 V  D  T  S  L  G  K  F  F  I  G  Q  F  S  D  D  R  H  C  S         p.580

          .         .         .         .         .         .       g.21637
 AGATTTAGGACTCTAGTGGCACACTATCCCCCAGTACAAGTTTTATTTGAAAAAGGAAAT       c.1800
 R  F  R  T  L  V  A  H  Y  P  P  V  Q  V  L  F  E  K  G  N         p.600

          .         .         .         .         .         .       g.21697
 CTCTCAAAGGAAACTAAAACAATTCTAAAGAGTTCATTGTCCTGTTCTCTTCAGGAAGGT       c.1860
 L  S  K  E  T  K  T  I  L  K  S  S  L  S  C  S  L  Q  E  G         p.620

          .         .         .         .         .         .       g.21757
 CTGATACCCGGCTCCCAGTTTTGGGATGCATCCAAAACTTTGAGAACTCTCCTTGAGGAA       c.1920
 L  I  P  G  S  Q  F  W  D  A  S  K  T  L  R  T  L  L  E  E         p.640

          .         .         .         .         .         .       g.21817
 GAATATTTTAGGGAAAAGCTAAGTGATGGCATTGGGGTGATGTTACCCCAGGTGCTTAAA       c.1980
 E  Y  F  R  E  K  L  S  D  G  I  G  V  M  L  P  Q  V  L  K         p.660

          .         .         .         .         .         .       g.21877
 GGTATGACTTCAGAGTCTGATTCCATTGGGTTGACACCAGGAGAGAAAAGTGAATTGGCC       c.2040
 G  M  T  S  E  S  D  S  I  G  L  T  P  G  E  K  S  E  L  A         p.680

          .         .         .         .         .         .       g.21937
 CTCTCTGCTCTAGGTGGTTGTGTCTTCTACCTCAAAAAATGCCTTATTGATCAGGAGCTT       c.2100
 L  S  A  L  G  G  C  V  F  Y  L  K  K  C  L  I  D  Q  E  L         p.700

          .         .         .         .         .         .       g.21997
 TTATCAATGGCTAATTTTGAAGAATATATTCCCTTGGATTCTGACACAGTCAGCACTACA       c.2160
 L  S  M  A  N  F  E  E  Y  I  P  L  D  S  D  T  V  S  T  T         p.720

          .         .         .         .         .         .       g.22057
 AGATCTGGTGCTATCTTCACCAAAGCCTATCAACGAATGGTGCTAGATGCAGTGACATTA       c.2220
 R  S  G  A  I  F  T  K  A  Y  Q  R  M  V  L  D  A  V  T  L         p.740

          .         .         .         .         .         .       g.22117
 AACAACTTGGAGATTTTTCTGAATGGAACAAATGGTTCTACTGAAGGAACCCTACTAGAG       c.2280
 N  N  L  E  I  F  L  N  G  T  N  G  S  T  E  G  T  L  L  E         p.760

          .         .         .         .         .         .       g.22177
 AGGGTTGATACTTGCCATACTCCTTTTGGTAAGCGGCTCCTAAAGCAATGGCTTTGTGCC       c.2340
 R  V  D  T  C  H  T  P  F  G  K  R  L  L  K  Q  W  L  C  A         p.780

          .         .         .         .         .         .       g.22237
 CCACTCTGTAACCATTATGCTATTAATGATCGTCTAGATGCCATAGAAGACCTCATGGTT       c.2400
 P  L  C  N  H  Y  A  I  N  D  R  L  D  A  I  E  D  L  M  V         p.800

          .         .         .         .         .         .       g.22297
 GTGCCTGACAAAATCTCCGAAGTTGTAGAGCTTCTAAAGAAGCTTCCAGATCTTGAGAGG       c.2460
 V  P  D  K  I  S  E  V  V  E  L  L  K  K  L  P  D  L  E  R         p.820

          .         .         .         .         .         .       g.22357
 CTACTCAGTAAAATTCATAATGTTGGGTCTCCCCTGAAGAGTCAGAACCACCCAGACAGC       c.2520
 L  L  S  K  I  H  N  V  G  S  P  L  K  S  Q  N  H  P  D  S         p.840

          .         .         .         .         .         .       g.22417
 AGGGCTATAATGTATGAAGAAACTACATACAGCAAGAAGAAGATTATTGATTTTCTTTCT       c.2580
 R  A  I  M  Y  E  E  T  T  Y  S  K  K  K  I  I  D  F  L  S         p.860

          .         .         .         .         .         .       g.22477
 GCTCTGGAAGGATTCAAAGTAATGTGTAAAATTATAGGGATCATGGAAGAAGTTGCTGAT       c.2640
 A  L  E  G  F  K  V  M  C  K  I  I  G  I  M  E  E  V  A  D         p.880

          .         .         .         .         .         .       g.22537
 GGTTTTAAGTCTAAAATCCTTAAGCAGGTCATCTCTCTGCAGACAAAAAATCCTGAAGGT       c.2700
 G  F  K  S  K  I  L  K  Q  V  I  S  L  Q  T  K  N  P  E  G         p.900

          .         .         .         .         .         .       g.22597
 CGTTTTCCTGATTTGACTGTAGAATTGAACCGATGGGATACAGCCTTTGACCATGAAAAG       c.2760
 R  F  P  D  L  T  V  E  L  N  R  W  D  T  A  F  D  H  E  K         p.920

          .         .         .         .         .         .       g.22657
 GCTCGAAAGACTGGACTTATTACTCCCAAAGCAGGCTTTGACTCTGATTATGACCAAGCT       c.2820
 A  R  K  T  G  L  I  T  P  K  A  G  F  D  S  D  Y  D  Q  A         p.940

          .         .         .         .         .         .       g.22717
 CTTGCTGACATAAGAGAAAATGAACAGAGCCTCCTGGAATACCTAGAGAAACAGCGCAAC       c.2880
 L  A  D  I  R  E  N  E  Q  S  L  L  E  Y  L  E  K  Q  R  N         p.960

          .         .         .         .         .         .       g.22777
 AGAATTGGCTGTAGGACCATAGTCTATTGGGGGATTGGTAGGAACCGTTACCAGCTGGAA       c.2940
 R  I  G  C  R  T  I  V  Y  W  G  I  G  R  N  R  Y  Q  L  E         p.980

          .         .         .         .         .         .       g.22837
 ATTCCTGAGAATTTCACCACTCGCAATTTGCCAGAAGAATACGAGTTGAAATCTACCAAG       c.3000
 I  P  E  N  F  T  T  R  N  L  P  E  E  Y  E  L  K  S  T  K         p.1000

          .         .         .         .         .         .       g.22897
 AAGGGCTGTAAACGATACTGGACCAAAACTATTGAAAAGAAGTTGGCTAATCTCATAAAT       c.3060
 K  G  C  K  R  Y  W  T  K  T  I  E  K  K  L  A  N  L  I  N         p.1020

          .         .         .         .         .         .       g.22957
 GCTGAAGAACGGAGGGATGTATCATTGAAGGACTGCATGCGGCGACTGTTCTATAACTTT       c.3120
 A  E  E  R  R  D  V  S  L  K  D  C  M  R  R  L  F  Y  N  F         p.1040

          .         .         .         .         .   | 05     .    g.25281
 GATAAAAATTACAAGGACTGGCAGTCTGCTGTAGAGTGTATCGCAGTGTTGG | ATGTTTTA    c.3180
 D  K  N  Y  K  D  W  Q  S  A  V  E  C  I  A  V  L  D |   V  L      p.1060

          .         .         .         .         .         .       g.25341
 CTGTGCCTGGCTAACTATAGTCGAGGGGGTGATGGTCCTATGTGTCGCCCAGTAATTCTG       c.3240
 L  C  L  A  N  Y  S  R  G  G  D  G  P  M  C  R  P  V  I  L         p.1080

          .         .         .         .         .         .       g.25401
 TTGCCGGAAGATACCCCCCCCTTCTTAGAGCTTAAAGGATCACGCCATCCTTGCATTACG       c.3300
 L  P  E  D  T  P  P  F  L  E  L  K  G  S  R  H  P  C  I  T         p.1100

          .         .         .         .         .         .       g.25461
 AAGACTTTTTTTGGAGATGATTTTATTCCTAATGACATTCTAATAGGCTGTGAGGAAGAG       c.3360
 K  T  F  F  G  D  D  F  I  P  N  D  I  L  I  G  C  E  E  E         p.1120

          .         .         .         .         .         .       g.25521
 GAGCAGGAAAATGGCAAAGCCTATTGTGTGCTTGTTACTGGACCAAATATGGGGGGCAAG       c.3420
 E  Q  E  N  G  K  A  Y  C  V  L  V  T  G  P  N  M  G  G  K         p.1140

          .         | 06         .         .         .         .    g.26805
 TCTACGCTTATGAGACAG | GCTGGCTTATTAGCTGTAATGGCCCAGATGGGTTGTTACGTC    c.3480
 S  T  L  M  R  Q   | A  G  L  L  A  V  M  A  Q  M  G  C  Y  V      p.1160

          .         .         .         .         .         .       g.26865
 CCTGCTGAAGTGTGCAGGCTCACACCAATTGATAGAGTGTTTACTAGACTTGGTGCCTCA       c.3540
 P  A  E  V  C  R  L  T  P  I  D  R  V  F  T  R  L  G  A  S         p.1180

          .       | 07 .         .         .         .         .    g.27515
 GACAGAATAATGTCAG | GTGAAAGTACATTTTTTGTTGAATTAAGTGAAACTGCCAGCATA    c.3600
 D  R  I  M  S  G |   E  S  T  F  F  V  E  L  S  E  T  A  S  I      p.1200

          .         .         .         .       | 08 .         .    g.28071
 CTCATGCATGCAACAGCACATTCTCTGGTGCTTGTGGATGAATTAG | GAAGAGGTACTGCA    c.3660
 L  M  H  A  T  A  H  S  L  V  L  V  D  E  L  G |   R  G  T  A      p.1220

          .         .         .         .         .         .       g.28131
 ACATTTGATGGGACGGCAATAGCAAATGCAGTTGTTAAAGAACTTGCTGAGACTATAAAA       c.3720
 T  F  D  G  T  A  I  A  N  A  V  V  K  E  L  A  E  T  I  K         p.1240

          .         .         .         .         .         .       g.28191
 TGTCGTACATTATTTTCAACTCACTACCATTCATTAGTAGAAGATTATTCTCAAAATGTT       c.3780
 C  R  T  L  F  S  T  H  Y  H  S  L  V  E  D  Y  S  Q  N  V         p.1260

          .         .  | 09      .         .         .         .    g.28344
 GCTGTGCGCCTAGGACATATG | GCATGCATGGTAGAAAATGAATGTGAAGACCCCAGCCAG    c.3840
 A  V  R  L  G  H  M   | A  C  M  V  E  N  E  C  E  D  P  S  Q      p.1280

          .         .         .         .         .         .       g.28404
 GAGACTATTACGTTCCTCTATAAATTCATTAAGGGAGCTTGTCCTAAAAGCTATGGCTTT       c.3900
 E  T  I  T  F  L  Y  K  F  I  K  G  A  C  P  K  S  Y  G  F         p.1300

          .         .         .         .         .         .       g.28464
 AATGCAGCAAGGCTTGCTAATCTCCCAGAGGAAGTTATTCAAAAGGGACATAGAAAAGCA       c.3960
 N  A  A  R  L  A  N  L  P  E  E  V  I  Q  K  G  H  R  K  A         p.1320

          .         .         .         .  | 10      .         .    g.28651
 AGAGAATTTGAGAAGATGAATCAGTCACTACGATTATTTCG | GGAAGTTTGCCTGGCTAGT    c.4020
 R  E  F  E  K  M  N  Q  S  L  R  L  F  R  |  E  V  C  L  A  S      p.1340

          .         .         .         .         .         .       g.28711
 GAAAGGTCAACTGTAGATGCTGAAGCTGTCCATAAATTGCTGACTTTGATTAAGGAATTA       c.4080
 E  R  S  T  V  D  A  E  A  V  H  K  L  L  T  L  I  K  E  L         p.1360

                                                                    g.28714
 TAG                                                                c.4083
 X                                                                  p.1360

          .         .         .         .         .         .       g.28774
 actgactacattggaagctttgagttgacttctgacaaaggtggtaaattcagacaacat       c.*60

          .         .         .                                     g.28807
 tatgatctaataaactttattttttaaaaatga                                  c.*93

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The MutS homolog 6 (E. coli) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 11
©2004-2014 Leiden University Medical Center