fumarate hydratase (FH) - coding DNA reference sequence

(used for variant description)

(last modified August 19, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_000143.3 in the FH gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012338.1, covering FH transcript NM_000143.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.4972
                                                          gac       c.-61

 .         .         .         .         .         .                g.5032
 aaccggcgtggaggcgtggccacagccgcccagaaattctacccaagctccctcagcacc       c.-1

          .         .         .         .         .         .       g.5092
 ATGTACCGAGCACTTCGGCTCCTCGCGCGCTCGCGTCCCCTCGTGCGGGCTCCAGCCGCA       c.60
 M  Y  R  A  L  R  L  L  A  R  S  R  P  L  V  R  A  P  A  A         p.20

          .         .         .         .         .         .       g.5152
 GCCTTAGCTTCGGCTCCCGGCTTGGGTGGCGCGGCCGTGCCCTCGTTTTGGCCTCCGAAC       c.120
 A  L  A  S  A  P  G  L  G  G  A  A  V  P  S  F  W  P  P  N         p.40

          .   | 02     .         .         .         .         .    g.7486
 GCGGCTCGAATG | GCAAGCCAAAATTCCTTCCGGATAGAATATGATACCTTTGGTGAACTA    c.180
 A  A  R  M   | A  S  Q  N  S  F  R  I  E  Y  D  T  F  G  E  L      p.60

          .         .         .         .         .         .       g.7546
 AAGGTGCCAAATGATAAGTATTATGGCGCCCAGACCGTGAGATCTACGATGAACTTTAAG       c.240
 K  V  P  N  D  K  Y  Y  G  A  Q  T  V  R  S  T  M  N  F  K         p.80

          .         .        | 03.         .         .         .    g.11074
 ATTGGAGGTGTGACAGAACGCATGCCA | ACCCCAGTTATTAAAGCTTTTGGCATCTTGAAG    c.300
 I  G  G  V  T  E  R  M  P   | T  P  V  I  K  A  F  G  I  L  K      p.100

          .         .         .         .         .         .       g.11134
 CGAGCGGCCGCTGAAGTAAACCAGGATTATGGTCTTGATCCAAAGATTGCTAATGCAATA       c.360
 R  A  A  A  E  V  N  Q  D  Y  G  L  D  P  K  I  A  N  A  I         p.120

          .         | 04         .         .         .         .    g.12653
 ATGAAGGCAGCAGATGAG | GTAGCTGAAGGTAAATTAAATGATCATTTTCCTCTCGTGGTA    c.420
 M  K  A  A  D  E   | V  A  E  G  K  L  N  D  H  F  P  L  V  V      p.140

          .         .         .         .         .         .       g.12713
 TGGCAGACTGGATCAGGAACTCAGACAAATATGAATGTAAATGAAGTCATTAGCAATAGA       c.480
 W  Q  T  G  S  G  T  Q  T  N  M  N  V  N  E  V  I  S  N  R         p.160

          .         .         .         .         .         .       g.12773
 GCAATTGAAATGTTAGGAGGTGAACTTGGCAGCAAGATACCTGTGCATCCCAACGATCAT       c.540
 A  I  E  M  L  G  G  E  L  G  S  K  I  P  V  H  P  N  D  H         p.180

          .      | 05  .         .         .         .         .    g.16014
 GTTAATAAAAGCCAG | AGCTCAAATGATACTTTTCCCACAGCAATGCACATTGCTGCTGCA    c.600
 V  N  K  S  Q   | S  S  N  D  T  F  P  T  A  M  H  I  A  A  A      p.200

          .         .         .         .         .         .       g.16074
 ATAGAAGTTCATGAAGTACTGTTACCAGGACTACAGAAGTTACATGATGCTCTTGATGCA       c.660
 I  E  V  H  E  V  L  L  P  G  L  Q  K  L  H  D  A  L  D  A         p.220

          .         .         .         .         .         .       g.16134
 AAATCCAAAGAGTTTGCACAGATCATCAAGATTGGACGTACTCATACTCAGGATGCTGTT       c.720
 K  S  K  E  F  A  Q  I  I  K  I  G  R  T  H  T  Q  D  A  V         p.240

          .         | 06         .         .         .         .    g.18628
 CCACTTACTCTTGGGCAG | GAATTTAGTGGTTATGTTCAACAAGTAAAATATGCAATGACA    c.780
 P  L  T  L  G  Q   | E  F  S  G  Y  V  Q  Q  V  K  Y  A  M  T      p.260

          .         .         .         .         .         .       g.18688
 AGAATAAAAGCTGCCATGCCAAGAATCTATGAGCTCGCAGCTGGAGGCACTGCTGTTGGT       c.840
 R  I  K  A  A  M  P  R  I  Y  E  L  A  A  G  G  T  A  V  G         p.280

          .         .         .         .         .         .       g.18748
 ACAGGTTTAAATACTAGAATTGGCTTTGCAGAAAAGGTTGCTGCAAAAGTGGCTGCACTT       c.900
 T  G  L  N  T  R  I  G  F  A  E  K  V  A  A  K  V  A  A  L         p.300

      | 07   .         .         .         .         .         .    g.20565
 ACAG | GCTTGCCTTTTGTCACTGCTCCGAATAAATTTGAAGCTCTGGCTGCTCATGACGCT    c.960
 T  G |   L  P  F  V  T  A  P  N  K  F  E  A  L  A  A  H  D  A      p.320

          .         .         .         .         .         .       g.20625
 CTGGTTGAGCTCAGTGGAGCCATGAACACTACTGCCTGCAGTCTGATGAAGATAGCAAAT       c.1020
 L  V  E  L  S  G  A  M  N  T  T  A  C  S  L  M  K  I  A  N         p.340

          .         .         .         .         .         .       g.20685
 GATATTCGATTTTTGGGTTCTGGTCCTCGGTCAGGTCTGGGAGAATTGATCTTGCCTGAA       c.1080
 D  I  R  F  L  G  S  G  P  R  S  G  L  G  E  L  I  L  P  E         p.360

          .         .         | 08         .         .         .    g.22216
 AATGAACCAGGAAGCAGTATCATGCCAG | GCAAGGTGAACCCTACTCAGTGTGAAGCAATG    c.1140
 N  E  P  G  S  S  I  M  P  G |   K  V  N  P  T  Q  C  E  A  M      p.380

          .         .         .         .         .         .       g.22276
 ACCATGGTTGCAGCCCAAGTCATGGGGAACCATGTTGCTGTCACTGTCGGAGGCAGCAAT       c.1200
 T  M  V  A  A  Q  V  M  G  N  H  V  A  V  T  V  G  G  S  N         p.400

          .         .         .       | 09 .         .         .    g.24188
 GGACATTTTGAGTTGAATGTTTTCAAGCCAATGATG | ATTAAAAATGTGTTACACTCAGCC    c.1260
 G  H  F  E  L  N  V  F  K  P  M  M   | I  K  N  V  L  H  S  A      p.420

          .         .         .         .         .         .       g.24248
 AGGCTGCTGGGGGATGCTTCAGTTTCCTTTACAGAAAACTGCGTGGTGGGAATCCAGGCC       c.1320
 R  L  L  G  D  A  S  V  S  F  T  E  N  C  V  V  G  I  Q  A         p.440

          .         .         .         .         .         .       g.24308
 AATACAGAAAGGATCAACAAGCTGATGAATGAGTCTCTAATGTTGGTGACAGCTCTCAAT       c.1380
 N  T  E  R  I  N  K  L  M  N  E  S  L  M  L  V  T  A  L  N         p.460

          . | 10       .         .         .         .         .    g.26834
 CCTCATATAG | GGTATGACAAGGCAGCAAAGATTGCTAAGACAGCACACAAAAATGGATCA    c.1440
 P  H  I  G |   Y  D  K  A  A  K  I  A  K  T  A  H  K  N  G  S      p.480

          .         .         .         .         .         .       g.26894
 ACCTTAAAGGAAACTGCTATCGAACTTGGCTATCTCACAGCAGAGCAGTTTGACGAATGG       c.1500
 T  L  K  E  T  A  I  E  L  G  Y  L  T  A  E  Q  F  D  E  W         p.500

          .         .         .                                     g.26927
 GTAAAACCTAAGGACATGCTGGGTCCAAAGTGA                                  c.1533
 V  K  P  K  D  M  L  G  P  K  X                                    p.510

          .         .         .         .         .         .       g.26987
 tttacataaatttataatgaaaataaacatgtataaaatttaaaaaaacagactcccatt       c.*60

          .         .         .         .         .         .       g.27047
 tcttaaaaacggataagtttgaaaggaaactgctattgaacttaagcatctctagcagag       c.*120

          .         .         .         .         .         .       g.27107
 caatttgatcagtatataaaaccctaggatgtgctaggtctaagatggattaaacaagta       c.*180

          .         .         .         .         .         .       g.27167
 taaaataaaatacatttataaaataaaaaggaaaacagacttaaattttctcctatgtta       c.*240

          .         .         .                                     g.27198
 attgacttgtattatagttgaatctatgata                                    c.*271

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Fumarate hydratase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center