forkhead box N1 (FOXN1) - coding DNA reference sequence

(used for variant description)

(last modified January 7, 2018)


This file was created to facilitate the description of sequence variants on transcript NM_003593.2 in the FOXN1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007260.1, covering FOXN1 transcript NM_003593.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5029
                                acggctttctttgaggccaggactgggtg       c.-1

          .         .         .         .         .         .       g.5089
 ATGGTGTCGCTACCCCCGCCGCAGTCTGACGTCACGCTGCCGGGCCCCACCAGACTGGAG       c.60
 M  V  S  L  P  P  P  Q  S  D  V  T  L  P  G  P  T  R  L  E         p.20

          .         .         .         .         .         .       g.5149
 GGCGAGCGCCAAGGGGACCTCATGCAGGCACCGGGCCTCCCAGGCTCCCCTGCCCCACAG       c.120
 G  E  R  Q  G  D  L  M  Q  A  P  G  L  P  G  S  P  A  P  Q         p.40

     | 02    .         .         .         .         .         .    g.5619
 AGT | AAGCATGCCGGCTTCAGCTGCTCGTCATTTGTGTCCGACGGCCCTCCAGAGAGGACA    c.180
 S   | K  H  A  G  F  S  C  S  S  F  V  S  D  G  P  P  E  R  T      p.60

          .         .         .         .         .         .       g.5679
 CCCTCACTGCCCCCACACAGCCCCCGCATTGCGTCACCAGGGCCCGAGCAAGTCCAGGGC       c.240
 P  S  L  P  P  H  S  P  R  I  A  S  P  G  P  E  Q  V  Q  G         p.80

          .         .         .         .         .         .       g.5739
 CACTGCCCAGCCGGCCCCGGCCCTGGGCCCTTCAGGCTCTCACCCTCAGACAAGTATCCT       c.300
 H  C  P  A  G  P  G  P  G  P  F  R  L  S  P  S  D  K  Y  P         p.100

          .         .         .         .         .         .       g.5799
 GGCTTTGGCTTTGAGGAGGCCGCAGCAAGCAGCCCTGGGCGATTCCTCAAGGGCAGCCAC       c.360
 G  F  G  F  E  E  A  A  A  S  S  P  G  R  F  L  K  G  S  H         p.120

          .         .         .         .         .         .       g.5859
 GCGCCCTTCCACCCGTACAAGCGGCCTTTCCATGAGGACGTCTTCCCAGAGGCCGAGACC       c.420
 A  P  F  H  P  Y  K  R  P  F  H  E  D  V  F  P  E  A  E  T         p.140

          .         .         .         .         .         .       g.5919
 ACCCTGGCCCTCAAAGGACACTCCTTTAAGACCCCAGGGCCGCTGGAGGCCTTCGAGGAG       c.480
 T  L  A  L  K  G  H  S  F  K  T  P  G  P  L  E  A  F  E  E         p.160

          .         .         .         .         .         .       g.5979
 ATCCCAGTGGACGTGGCGGAGGCCGAGGCCTTCCTGCCTGGCTTCTCAGCAGAGGCCTGG       c.540
 I  P  V  D  V  A  E  A  E  A  F  L  P  G  F  S  A  E  A  W         p.180

          .         .         .         .         | 03         .    g.8322
 TGTAACGGGCTCCCCTACCCCAGCCAGGAGCATGGCCCCCAAGTCCTG | GGTTCAGAGGTC    c.600
 C  N  G  L  P  Y  P  S  Q  E  H  G  P  Q  V  L   | G  S  E  V      p.200

          .         .         .         .         .         .       g.8382
 AAAGTCAAGCCCCCAGTTCTGGAGAGTGGTGCTGGGATGTTCTGCTACCAGCCTCCCTTG       c.660
 K  V  K  P  P  V  L  E  S  G  A  G  M  F  C  Y  Q  P  P  L         p.220

          .         .         .          | 04        .         .    g.10174
 CAGCATATGTACTGCTCCTCCCAGCCCCCCTTCCACCAG | TACTCGCCAGGTGGTGGCAGC    c.720
 Q  H  M  Y  C  S  S  Q  P  P  F  H  Q   | Y  S  P  G  G  G  S      p.240

          .         .         .         .         .         .       g.10234
 TACCCCATACCCTACCTGGGCTCCTCACACTATCAGTACCAGCGAATGGCACCCCAGGCC       c.780
 Y  P  I  P  Y  L  G  S  S  H  Y  Q  Y  Q  R  M  A  P  Q  A         p.260

          .         .         .         .         . | 05       .    g.11818
 AGCACCGATGGGCACCAGCCTCTCTTCCCAAAACCCATCTATTCCTACAG | CATCCTCATC    c.840
 S  T  D  G  H  Q  P  L  F  P  K  P  I  Y  S  Y  S  |  I  L  I      p.280

          .         .         .         .         .         .       g.11878
 TTCATGGCCCTTAAGAACAGTAAAACTGGGAGCCTTCCCGTCAGCGAGATCTACAATTTT       c.900
 F  M  A  L  K  N  S  K  T  G  S  L  P  V  S  E  I  Y  N  F         p.300

          .         .        | 06.         .         .         .    g.15423
 ATGACGGAGCACTTTCCTTACTTCAAG | ACAGCACCCGATGGCTGGAAGAATTCTGTCCGG    c.960
 M  T  E  H  F  P  Y  F  K   | T  A  P  D  G  W  K  N  S  V  R      p.320

          .         .         .         .         .         .       g.15483
 CACAACCTATCCCTCAACAAGTGCTTCGAGAAGGTGGAGAACAAATCAGGAAGTTCCTCC       c.1020
 H  N  L  S  L  N  K  C  F  E  K  V  E  N  K  S  G  S  S  S         p.340

          .         .         .         .         .         .       g.15543
 CGCAAGGGCTGCCTGTGGGCCCTCAATCCGGCCAAGATCGACAAGATGCAAGAGGAGCTG       c.1080
 R  K  G  C  L  W  A  L  N  P  A  K  I  D  K  M  Q  E  E  L         p.360

          .         .         .         .         .      | 07  .    g.15771
 CAAAAATGGAAGAGGAAAGATCCCATTGCTGTGCGCAAAAGCATGGCCAAGCCAG | AAGAG    c.1140
 Q  K  W  K  R  K  D  P  I  A  V  R  K  S  M  A  K  P  E |   E      p.380

          .         .         .         .         .         .       g.15831
 CTGGACAGCCTCATTGGAGACAAGAGAGAAAAGCTGGGCTCCCCACTCCTGGGCTGTCCG       c.1200
 L  D  S  L  I  G  D  K  R  E  K  L  G  S  P  L  L  G  C  P         p.400

          .         .         .         .         .         .       g.15891
 CCCCCTGGGCTGTCCGGCTCAGGCCCCATCCGGCCCCTGGCACCCCCAGCTGGCCTCTCC       c.1260
 P  P  G  L  S  G  S  G  P  I  R  P  L  A  P  P  A  G  L  S         p.420

          .         .         .         .         .         .       g.15951
 CCACCACTGCACTCACTCCACCCAGCTCCAGGCCCCATTCCTGGCAAGAACCCCCTGCAG       c.1320
 P  P  L  H  S  L  H  P  A  P  G  P  I  P  G  K  N  P  L  Q         p.440

          .         .         .         .         .         .       g.16011
 GACCTACTTATGGGGCACACACCCTCCTGCTATGGGCAGACATACTTGCACCTCTCACCA       c.1380
 D  L  L  M  G  H  T  P  S  C  Y  G  Q  T  Y  L  H  L  S  P         p.460

          .         .         .         .         .         .       g.16071
 GGCCTGGCCCCTCCTGGACCCCCGCAGCCATTGTTCCCACAGCCGGACGGGCACCTTGAG       c.1440
 G  L  A  P  P  G  P  P  Q  P  L  F  P  Q  P  D  G  H  L  E         p.480

          .         .         .         .         .         .       g.16131
 CTGCGGGCCCAGCCAGGCACCCCCCAGGACTCGCCTCTGCCTGCCCACACCCCACCCAGC       c.1500
 L  R  A  Q  P  G  T  P  Q  D  S  P  L  P  A  H  T  P  P  S         p.500

          .         .         .         .         .         .       g.16191
 CACAGTGCCAAGCTACTGGCCGAGCCTTCCCCAGCCAGGACTATGCACGACACCCTGCTG       c.1560
 H  S  A  K  L  L  A  E  P  S  P  A  R  T  M  H  D  T  L  L         p.520

          .         .         .         .         .         .       g.16251
 CCAGATGGAGACCTTGGCACTGACCTGGATGCCATCAATCCCTCACTCACTGACTTCGAC       c.1620
 P  D  G  D  L  G  T  D  L  D  A  I  N  P  S  L  T  D  F  D         p.540

         | 08.         .         .         .         .         .    g.18229
 TTCCAGG | GAAACCTGTGGGAACAGTTGAAGGATGATAGCTTGGCCCTCGACCCCCTGGTA    c.1680
 F  Q  G |   N  L  W  E  Q  L  K  D  D  S  L  A  L  D  P  L  V      p.560

          .         .         .         .         .         .       g.18289
 CTGGTGACCTCATCCCCGACATCATCTTCGATGCCACCACCCCAGCCACCACCTCACTGC       c.1740
 L  V  T  S  S  P  T  S  S  S  M  P  P  P  Q  P  P  P  H  C         p.580

          .         .         .         .         .         .       g.18349
 TTCCCCCCTGGGCCCTGTCTGACAGAGACAGGCAGTGGGGCAGGTGACTTGGCAGCCCCG       c.1800
 F  P  P  G  P  C  L  T  E  T  G  S  G  A  G  D  L  A  A  P         p.600

          .         .         .         .         .         .       g.18409
 GGCAGTGGTGGCTCCGGGGCACTGGGTGACCTGCACCTCACCACCCTCTACTCTGCCTTT       c.1860
 G  S  G  G  S  G  A  L  G  D  L  H  L  T  T  L  Y  S  A  F         p.620

          .         .         .         .         .         .       g.18469
 ATGGAGCTGGAGCCCACGCCCCCCACGGCCCCTGCAGGCCCCTCTGTGTACCTCAGCCCC       c.1920
 M  E  L  E  P  T  P  P  T  A  P  A  G  P  S  V  Y  L  S  P         p.640

          .         .                                               g.18496
 AGCTCCAAGCCCGTGGCCCTGGCATGA                                        c.1947
 S  S  K  P  V  A  L  A  X                                          p.648

          .         .         .         .         .         .       g.18556
 gctgtgcccagcttcgtcagctccagcgtttgcctggtctggaagtcctggccggccgcc       c.*60

          .         .         .         .         .         .       g.18616
 cacatcgggctcaccttaaaggtcaaggaaggaaaatactacctgtcccctatgccacta       c.*120

          .         .         .         .         .         .       g.18676
 agccaacgtgtgtgtcagctggtagctgggggcgcagaggacatcacctggggtgctgcc       c.*180

          .         .         .         .         .         .       g.18736
 tctcacacatttctgccacgtggtggcccagctcctcacccagggcccccaaagagcaag       c.*240

          .         .         .         .         .         .       g.18796
 cgtctgggcaagaggaaaatgccctgtccctagctcacactcatccacacttaagccctc       c.*300

          .         .         .         .         .         .       g.18856
 gtgcacacacacaaattattcagatgtacacccacccacatatcttacagccagaggaac       c.*360

          .         .         .         .         .         .       g.18916
 cagcactccatcactgagagcccgacttcgtttctggggcaactgagagctgagcgcttt       c.*420

          .         .         .         .         .         .       g.18976
 gcttaccaaaagctcagggccctgtgccaggccaaagatccccccagacccccattctga       c.*480

          .         .         .         .         .         .       g.19036
 catccacatgctctgcagtcctggccccctcgtcattttctttcccagaagcgccctgta       c.*540

          .         .         .         .         .         .       g.19096
 tttattcccccatcttcatcccaacagcccagcaagaaggaggagacagagagctcctcc       c.*600

          .         .         .         .         .         .       g.19156
 ctgggttgtctgtggacccccccaggagctgctaattggcagcacccactcagccattct       c.*660

          .         .         .         .         .         .       g.19216
 ctacccatccttagtacatgctctgtccagctttccccagggtgacatacagaaggggca       c.*720

                                                                    g.19217
 a                                                                  c.*721

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Forkhead box N1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 20c
©2004-2018 Leiden University Medical Center