disabled homolog 1 (Drosophila) (DAB1) - coding DNA reference sequence

(used for variant description)

(last modified July 10, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_021080.3 in the DAB1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_046914.1, covering DAB1 transcript NM_021080.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5014
                                               ataaggtatgaaag       c.-661

 .         .         .         .         .         .                g.5074
 atgtggcctgcagagagccggcactatctctactgctgctgctgctgctactgctgctgt       c.-601

 .         .         .         .         .         .                g.5134
 tgctaccgctgcctctgctgccaccgccactactgctgccagcggagccgctaggagtga       c.-541

 .         .         .         .         .         .                g.5194
 gcatcccctctccgggatacccagctccgcggcgtctcccgcgcgccctggccccacacg       c.-481

 .         .         .         .         .         .                g.5254
 gacctgccagccccagggaacaaaagcggagcccgctcgccctctactgcagccggagga       c.-421

 .         .         .         .         .      | 02  .             g.371391
 tgagtcgagagggctgagcggagagtgtggtcctcggcggctggag | ctatttccttggct    c.-361

 .         .         .         .         .         .                g.371451
 tctctccatgacgattcctgactcgtggccccggcaatcttgggaagacatcatccagct       c.-301

 .         .         .         .         .         .                g.371511
 tcttcagtccagaccctgggcaccccccttttgccaggatcgtccccacccagcctggac       c.-241

 .         .         .          | 03        .         .             g.605904
 acattgactgaactgttttctaggacactg | cactcagcaagacatggtggtgagccctga    c.-181

 .         .         .         .         .    | 04    .             g.964389
 ctctcagtcttcatgattgaagaactcttttgtacaacacaaag | cactcaaaaagagtga    c.-121

 .         .         .         .         .         .                g.964449
 atgaaatgtgcagctcagagtgtcatttctgaagggaggagtctttctcttggagaagag       c.-61

 .         .         .         .         .         .                g.964509
 tcctcaatgagcctggccgaggcccgggatctgtgtgaagtggactaaggattaagtagg       c.-1

          .         .         .         .         .         .       g.964569
 ATGTCAACTGAGACAGAACTTCAAGTAGCTGTGAAAACCAGCGCCAAGAAAGACTCCAGA       c.60
 M  S  T  E  T  E  L  Q  V  A  V  K  T  S  A  K  K  D  S  R         p.20

         | 05.         .         .         .         .         .    g.1110163
 AAGAAAG | GTCAGGATCGCAGTGAAGCCACTTTGATAAAGAGGTTTAAAGGTGAAGGGGTC    c.120
 K  K  G |   Q  D  R  S  E  A  T  L  I  K  R  F  K  G  E  G  V      p.40

          .         .         .         .         .         .       g.1110223
 CGGTACAAAGCCAAATTGATCGGGATTGATGAAGTTTCCGCAGCTCGGGGAGACAAGTTA       c.180
 R  Y  K  A  K  L  I  G  I  D  E  V  S  A  A  R  G  D  K  L         p.60

          .         .        | 06.         .         .         .    g.1118931
 TGTCAAGATTCCATGATGAAACTCAAG | GGCGTTGTTGCTGGCGCTCGTTCCAAAGGAGAA    c.240
 C  Q  D  S  M  M  K  L  K   | G  V  V  A  G  A  R  S  K  G  E      p.80

          .         .         .         .         .         .       g.1118991
 CACAAACAGAAAATCTTTTTAACCATCTCCTTTGGAGGAATCAAAATCTTTGATGAGAAG       c.300
 H  K  Q  K  I  F  L  T  I  S  F  G  G  I  K  I  F  D  E  K         p.100

        | 07 .         .         .         .         .         .    g.1183179
 ACAGGG | GCCCTTCAGCATCATCATGCTGTTCATGAAATATCCTACATTGCAAAGGACATT    c.360
 T  G   | A  L  Q  H  H  H  A  V  H  E  I  S  Y  I  A  K  D  I      p.120

          .         .         .         .         .         .       g.1183239
 ACAGATCACCGGGCCTTTGGATATGTTTGTGGGAAGGAAGGGAATCACAGATTTGTGGCC       c.420
 T  D  H  R  A  F  G  Y  V  C  G  K  E  G  N  H  R  F  V  A         p.140

          .         | 08         .         .         .         .    g.1183940
 ATAAAAACAGCCCAGGCG | GCTGAACCTGTTATTCTGGACTTGAGAGATCTCTTTCAACTC    c.480
 I  K  T  A  Q  A   | A  E  P  V  I  L  D  L  R  D  L  F  Q  L      p.160

          .         .         .         .         .         .       g.1184000
 ATTTATGAATTGAAGCAAAGAGAAGAATTAGAAAAAAAGGCACAAAAGGATAAGCAGTGT       c.540
 I  Y  E  L  K  Q  R  E  E  L  E  K  K  A  Q  K  D  K  Q  C         p.180

          .         | 09         .         .         .        | 10. g.1186117
 GAACAAGCTGTGTACCAG | ACAATATTGGAAGAGGATGTTGAAGATCCTGTGTACCAG | TAC c.600
 E  Q  A  V  Y  Q   | T  I  L  E  E  D  V  E  D  P  V  Y  Q   | Y   p.200

          .         .         .         .         .         .       g.1186177
 ATTGTGTTTGAGGCTGGACACGAGCCAATCCGTGATCCCGAAACGGAAGAAAACATTTAT       c.660
 I  V  F  E  A  G  H  E  P  I  R  D  P  E  T  E  E  N  I  Y         p.220

     | 11    .         .         .         .         .         .    g.1192653
 CAG | GTTCCCACCAGCCAAAAGAAGGAAGGTGTTTATGATGTGCCAAAAAGTCAACCTGTA    c.720
 Q   | V  P  T  S  Q  K  K  E  G  V  Y  D  V  P  K  S  Q  P  V      p.240

     | 12    .         .         .         .         .         .    g.1229553
 AGT | GCTGTGACCCAATTAGAACTTTTTGGGGACATGTCCACACCCCCTGATATAACCTCT    c.780
 S   | A  V  T  Q  L  E  L  F  G  D  M  S  T  P  P  D  I  T  S      p.260

        | 13 .         .         .         .         .         .    g.1231954
 CCCCCC | ACTCCTGCAACTCCAGGTGATGCCTTTATCCCATCTTCATCTCAGACCCTTCCA    c.840
 P  P   | T  P  A  T  P  G  D  A  F  I  P  S  S  S  Q  T  L  P      p.280

          .         .         .         .         .      | 14  .    g.1240113
 GCGAGTGCAGATGTGTTTAGTTCTGTACCTTTCGGCACTGCTGCTGTACCCTCAG | GTTAC    c.900
 A  S  A  D  V  F  S  S  V  P  F  G  T  A  A  V  P  S  G |   Y      p.300

          .         .         .         .         .         .       g.1240173
 GTTGCAATGGGCGCTGTCCTCCCGTCCTTCTGGGGTCAGCAGCCCCTCGTCCAACAGCAG       c.960
 V  A  M  G  A  V  L  P  S  F  W  G  Q  Q  P  L  V  Q  Q  Q         p.320

          .         .         .         .         .         .       g.1240233
 ATGGTCATGGGTGCCCAGCCACCAGTCGCTCAGGTGATGCCGGGGGCTCAGCCCATCGCA       c.1020
 M  V  M  G  A  Q  P  P  V  A  Q  V  M  P  G  A  Q  P  I  A         p.340

          .         .         .         .         .         .       g.1240293
 TGGGGCCAGCCGGGTCTCTTTCCTGCCACTCAGCAGCCCTGGCCAACTGTGGCCGGGCAG       c.1080
 W  G  Q  P  G  L  F  P  A  T  Q  Q  P  W  P  T  V  A  G  Q         p.360

          .         .         .         .         .         .       g.1240353
 TTTCCGCCAGCCGCCTTCATGCCCACACAAACTGTTATGCCTTTGCCAGCTGCCATGTTC       c.1140
 F  P  P  A  A  F  M  P  T  Q  T  V  M  P  L  P  A  A  M  F         p.380

          .         .         .         .         .         .       g.1240413
 CAAGGTCCCCTCACCCCCCTTGCCACCGTCCCAGGCACGAGTGACTCCACCAGGTCAAGT       c.1200
 Q  G  P  L  T  P  L  A  T  V  P  G  T  S  D  S  T  R  S  S         p.400

          .         .         .         .         .         .       g.1240473
 CCACAGACCGACAAGCCCAGGCAGAAAATGGGCAAAGAAACGTTTAAGGATTTCCAGATG       c.1260
 P  Q  T  D  K  P  R  Q  K  M  G  K  E  T  F  K  D  F  Q  M         p.420

          .         .         .         .         .         .       g.1240533
 GCCCAGCCTCCGCCCGTGCCCTCCCGCAAACCCGACCAGCCCTCCCTCACCTGTACCTCA       c.1320
 A  Q  P  P  P  V  P  S  R  K  P  D  Q  P  S  L  T  C  T  S         p.440

          .         .         .         .         .         .       g.1240593
 GAGGCCTTCTCCAGTTACTTCAACAAAGTCGGGGTGGCACAGGATACAGACGACTGTGAT       c.1380
 E  A  F  S  S  Y  F  N  K  V  G  V  A  Q  D  T  D  D  C  D         p.460

          .         .         .         .         .         .       g.1240653
 GACTTTGACATCTCCCAGTTGAATTTGACCCCTGTGACTTCTACCACACCATCGACCAAC       c.1440
 D  F  D  I  S  Q  L  N  L  T  P  V  T  S  T  T  P  S  T  N         p.480

      | 15   .         .         .         .         .         .    g.1244323
 TCAC | CTCCAACCCCAGCCCCTAGACAGAGCTCTCCATCCAAATCATCTGCATCCCATGCC    c.1500
 S  P |   P  T  P  A  P  R  Q  S  S  P  S  K  S  S  A  S  H  A      p.500

          .         .         .         .         .         .       g.1244383
 AGTGATCCTACCACAGATGACATCTTTGAAGAGGGCTTTGAAAGTCCCAGCAAAAGCGAA       c.1560
 S  D  P  T  T  D  D  I  F  E  E  G  F  E  S  P  S  K  S  E         p.520

          .   | 16     .         .         .         .         .    g.1244797
 GAGCAAGAAGCT | CCTGATGGATCACAGGCCTCATCCAACAGTGATCCATTTGGTGAGCCC    c.1620
 E  Q  E  A   | P  D  G  S  Q  A  S  S  N  S  D  P  F  G  E  P      p.540

          .         .         .         .                           g.1244845
 AGTGGGGAGCCCAGTGGTGATAATATAAGTCCACAGGCCGGTAGCTAG                   c.1668
 S  G  E  P  S  G  D  N  I  S  P  Q  A  G  S  X                     p.555

          .      | 17  .         .         .         .         .    g.1257456
 atagcgcaggtctgg | gagccagagcctctgtacgcgcagatcaacagacctaagaaatag    c.*60

          .         .         .         .         .         .       g.1257516
 catcgatgcgagctcgtggtgggtgctcaagactggcatggacatcagcatcacgacagg       c.*120

          .         .         .         .         .         .       g.1257576
 ctctcttgtattctttcacctcttcccacaagaaattcatgattgcccaatggaactcgc       c.*180

          .         .         .         .         .                 g.1257634
 tcagaagagggaactaagcatttttggcaaccaatggcagatatctatggcagcacac         c.*238

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Disabled homolog 1 (Drosophila) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center