beta 3-glucosyltransferase (B3GLCT) - coding DNA reference sequence

(used for variant description)

(last modified July 8, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_194318.3 in the B3GLCT gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011732.1, covering B3GLCT transcript NM_194318.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5050
           agagaagggtcagccgcggcggcagggcggcggcggcagcggcgcagctc       c.-61

 .         .         .         .         .         .                g.5110
 cgctccccgcgcgtctcccttccccgcgcccaggtagggcgctcagcctccgccgccagg       c.-1

          .         .         .         .         .         .       g.5170
 ATGCGGCCGCCCGCCTGCTGGTGGCTGCTCGCGCCGCCGGCGCTGCTCGCGCTCCTCACC       c.60
 M  R  P  P  A  C  W  W  L  L  A  P  P  A  L  L  A  L  L  T         p.20

          . | 02       .         .         .         .         .    g.20126
 TGCTCCCTGG | CTTTTGGTTTGGCTTCTGAAGATACAAAGAAAGAGGTCAAGCAGTCTCAG    c.120
 C  S  L  A |   F  G  L  A  S  E  D  T  K  K  E  V  K  Q  S  Q      p.40

  | 03       .         .         .         . | 04       .         . g.34230
  | GATTTGGAGAAAAGTGGTATATCAAGGAAAAATGACATAG | ACTTAAAAGGAATTGTATTC c.180
  | D  L  E  K  S  G  I  S  R  K  N  D  I  D |   L  K  G  I  V  F   p.60

          .         .         .         .         .         .       g.34290
 GTCATCCAGAGTCAAAGTAATTCTTTTCATGCAAAGAGAGCAGAGCAGTTAAAAAAAAGC       c.240
 V  I  Q  S  Q  S  N  S  F  H  A  K  R  A  E  Q  L  K  K  S         p.80

          .         .         . | 05       .         .         .    g.52078
 ATCTTAAAGCAGGCTGCAGATCTTACACAG | GAGCTCCCCAGTGTCCTCCTCCTTCATCAG    c.300
 I  L  K  Q  A  A  D  L  T  Q   | E  L  P  S  V  L  L  L  H  Q      p.100

          .         .         .         .        | 06.         .    g.52893
 CTGGCTAAACAAGAAGGTGCATGGACCATACTTCCGTTGTTACCGCA | TTTTTCTGTAACA    c.360
 L  A  K  Q  E  G  A  W  T  I  L  P  L  L  P  H  |  F  S  V  T      p.120

          .         .         .         .         .         .       g.52953
 TATAGCAGAAATTCATCTTGGATTTTCTTCTGTGAAGAAGAGACAAGAATACAGATTCCA       c.420
 Y  S  R  N  S  S  W  I  F  F  C  E  E  E  T  R  I  Q  I  P         p.140

          .         .         .          | 07        .         .    g.65992
 AAACTCTTGGAAACCCTCAGAAGATATGACCCCTCTAAG | GAATGGTTTTTGGGAAAAGCA    c.480
 K  L  L  E  T  L  R  R  Y  D  P  S  K   | E  W  F  L  G  K  A      p.160

          .         .         .         .         .         .       g.66052
 TTACATGATGAAGAAGCTACAATAATTCACCATTATGCCTTTTCCGAGAATCCTACAGTT       c.540
 L  H  D  E  E  A  T  I  I  H  H  Y  A  F  S  E  N  P  T  V         p.180

          .         .         .         .         .       | 08 .    g.74243
 TTTAAGTATCCAGACTTTGCTGCAGGCTGGGCCTTAAGTATTCCACTTGTAAACAA | GCTT    c.600
 F  K  Y  P  D  F  A  A  G  W  A  L  S  I  P  L  V  N  K  |  L      p.200

          .         .         .         .         .         .       g.74303
 ACCAAGAGACTAAAGAGTGAATCCTTGAAATCCGACTTTACAATAGATTTAAAACATGAG       c.660
 T  K  R  L  K  S  E  S  L  K  S  D  F  T  I  D  L  K  H  E         p.220

  | 09       .         .         .         .         .         .    g.79594
  | ATTGCCCTCTACATCTGGGACAAAGGCGGAGGACCTCCCCTGACCCCAGTGCCTGAGTTT    c.720
  | I  A  L  Y  I  W  D  K  G  G  G  P  P  L  T  P  V  P  E  F      p.240

          .         .         .         .         .         .       g.79654
 TGTACCAATGACGTGGACTTCTACTGTGCTACCACATTCCATTCTTTTCTACCGCTTTGT       c.780
 C  T  N  D  V  D  F  Y  C  A  T  T  F  H  S  F  L  P  L  C         p.260

  | 10       .         .         .         .         .         .    g.81787
  | AGAAAGCCAGTGAAGAAGAAGGATATTTTTGTTGCAGTAAAAACATGCAAGAAATTTCAT    c.840
  | R  K  P  V  K  K  K  D  I  F  V  A  V  K  T  C  K  K  F  H      p.280

          . | 11       .         .         .         .         .    g.89723
 GGTGACAGAA | TACCTATTGTTAAGCAGACTTGGGAGAGCCAGGCAAGTCTCATTGAATAC    c.900
 G  D  R  I |   P  I  V  K  Q  T  W  E  S  Q  A  S  L  I  E  Y      p.300

          .         .         .         .         .         .       g.89783
 TATAGTGACTATACTGAAAATTCCATTCCTACTGTGGATTTGGGAATTCCTAATACAGAT       c.960
 Y  S  D  Y  T  E  N  S  I  P  T  V  D  L  G  I  P  N  T  D         p.320

      | 12   .         .         .         .         .         .    g.91801
 AGAG | GTCATTGTGGAAAGACATTTGCCATTTTGGAAAGATTTCTGAATCGTAGCCAGGAC    c.1020
 R  G |   H  C  G  K  T  F  A  I  L  E  R  F  L  N  R  S  Q  D      p.340

          .         .         .         .     | 13   .         .    g.122607
 AAAACAGCATGGTTAGTCATTGTGGATGATGATACATTAATAAG | TATCTCCAGGCTCCAG    c.1080
 K  T  A  W  L  V  I  V  D  D  D  T  L  I  S  |  I  S  R  L  Q      p.360

          .         .         .         .         .         .       g.122667
 CACTTGCTTAGCTGTTATGACTCCGGCGAGCCTGTGTTTCTGGGAGAGCGCTACGGCTAC       c.1140
 H  L  L  S  C  Y  D  S  G  E  P  V  F  L  G  E  R  Y  G  Y         p.380

          .         .         .         .     | 14   .         .    g.128792
 GGCCTGGGCACTGGTGGCTACAGCTACATCACGGGAGGAGGAGG | AATGGTCTTCAGCAGA    c.1200
 G  L  G  T  G  G  Y  S  Y  I  T  G  G  G  G  |  M  V  F  S  R      p.400

          .         .         .         .         .         .       g.128852
 GAAGCCGTCAGGAGACTTCTCGCCAGTAAATGTCGATGCTACAGCAATGATGCTCCCGAT       c.1260
 E  A  V  R  R  L  L  A  S  K  C  R  C  Y  S  N  D  A  P  D         p.420

          .         .         .         .         .         .       g.128912
 GATATGGTCCTGGGAATGTGCTTTAGTGGCTTGGGAATCCCTGTGACACACAGCCCTCTC       c.1320
 D  M  V  L  G  M  C  F  S  G  L  G  I  P  V  T  H  S  P  L         p.440

           | 15        .         .         .         .         .    g.134577
 TTCCATCAG | GCTCGGCCGGTGGATTACCCTAAGGACTACCTTTCTCATCAAGTTCCCATA    c.1380
 F  H  Q   | A  R  P  V  D  Y  P  K  D  Y  L  S  H  Q  V  P  I      p.460

          .         .         .         .         .         .       g.134637
 TCGTTCCACAAACACTGGAACATCGATCCAGTGAAGGTGTATTTCACATGGTTGGCACCC       c.1440
 S  F  H  K  H  W  N  I  D  P  V  K  V  Y  F  T  W  L  A  P         p.480

          .         .         .         .         .                 g.134694
 AGTGACGAAGACAAAGCCAGGCAGGAGACACAGAAAGGTTTTCGAGAGGAGTTATAA          c.1497
 S  D  E  D  K  A  R  Q  E  T  Q  K  G  F  R  E  E  L  X            p.498

          .         .         .         .         .         .       g.134754
 atcagggtgacctgtgcgcctagcctgcgcagggaatgaactggagactgtggcctcatc       c.*60

          .         .         .         .         .         .       g.134814
 ccactgtgctgtgctcacaacacttgtgtctgccacatggcattgggtgcttcctgactt       c.*120

          .         .         .         .         .         .       g.134874
 tagggggagattttatgtatggtattttttgacagaggaagaaaaggggtcacaggagaa       c.*180

          .         .         .         .         .         .       g.134934
 acatttttttttctgggaaaaatcacttgcttttgacttatgcagttgttttaacactta       c.*240

          .         .         .         .         .         .       g.134994
 gtgatgactgtgtattctccaagctgtgatacagcagtttttttttattgtcacagggaa       c.*300

          .         .         .         .         .         .       g.135054
 ataaatggtaccagaagtccctttcctgttctgtctcttcattgtaatggaagtttcagt       c.*360

          .         .         .         .         .         .       g.135114
 tgggcatgagcctggagagatgtgactgtctacagttctatttgtatatataaaaagaag       c.*420

          .         .         .         .         .         .       g.135174
 actgaaagtcttttgacatggatattgtgaatggtatgaacttttaaaccatattattga       c.*480

          .         .         .         .         .         .       g.135234
 tgatgaaaattatttcctgggaactcagtaggaataataccgtattaaggaataatactg       c.*540

          .         .         .         .         .         .       g.135294
 tacataaaacatcatgaaaccctagatatgaaatcccctgaagtctgtaatcatggtggt       c.*600

          .         .         .         .         .         .       g.135354
 tatgttttgtctattcttttgctgtttgtgcctcataaaaagagaatgaggtcttctgct       c.*660

          .         .         .         .         .         .       g.135414
 agagcttcgtattgctttggaagttcatctgtgttttatttctccctgaagccctatctt       c.*720

          .         .         .         .         .         .       g.135474
 tatggcttacttgtaacatgaaagtagtagatgctgccagaaaatagtgtcctcaatatt       c.*780

          .         .         .         .         .         .       g.135534
 ttaaaacaatgttgacatgttttgttcaagtcagcaagctctatgtgagtctcaggaagt       c.*840

          .         .         .         .         .         .       g.135594
 gaattaaatttggaccttatgttttactcttgttttttttttttttttaaatgttactta       c.*900

          .         .         .         .         .         .       g.135654
 atgactctctcctgactcaggagagaaaccccttgtggaaggacagcatggtgatcaggc       c.*960

          .         .         .         .         .         .       g.135714
 aatttctctgggttcccaaagaatgacatttgaacacagtattttgaaacagctctagtt       c.*1020

          .         .         .         .         .         .       g.135774
 ttcaaattatatctttaatatatagtaatgtaacatattcagtattaatgtataaaaagc       c.*1080

          .         .         .         .         .         .       g.135834
 actctaattatataattcagtttttgtaaaggtatttgcataaaatttaatatgtcttaa       c.*1140

          .         .         .         .         .         .       g.135894
 actaattttggtaaattacttcttttttttctttttaataaaaactgttactcattaact       c.*1200

          .         .         .         .         .         .       g.135954
 ttgcttataatgctttttatagcccagcacagaatttaaagccataccaccaaaagtacc       c.*1260

          .         .         .         .         .         .       g.136014
 tgtgtgtgttaatatgtttttcttgtagcatagattgactatttgcaatagtattagtat       c.*1320

          .         .         .         .         .         .       g.136074
 ttaccatttttccaaattagcaactaccagacctcacgtgttgcagtgataacacaatgc       c.*1380

          .         .         .         .         .         .       g.136134
 attggattcagttttgtgaaaatggattctgtggccatccaagggatgtatcagggatga       c.*1440

          .         .         .         .         .         .       g.136194
 tcagctgatgagaggctccagaaggatttctagatcgcttcaagcctatactgatggcct       c.*1500

          .         .         .         .         .         .       g.136254
 tagctttgttcagtcattgtaactgggattgttgtcattgctaccgtggtagtcaccttc       c.*1560

          .         .         .         .         .         .       g.136314
 atgtcatctataatagtactcctggagagccctggctgcctacaccagtggaaaagagtc       c.*1620

          .         .         .         .         .         .       g.136374
 tccagttctgctctggcctactaactgttaccactgagagaacaacatgttcatttgaca       c.*1680

          .         .         .         .         .         .       g.136434
 tgattgaagctggcatccgtatatgaagatccttgtcaagctttcttctgtggtctgatt       c.*1740

          .         .         .         .         .         .       g.136494
 agtgccttctactgataccggggcacctcctctggtacttttaagtgttttgttaattat       c.*1800

          .         .         .         .         .         .       g.136554
 atttactttttggaatggtgtaagcctaaccacaagtaaaagatctttgcctaagttttt       c.*1860

          .         .         .         .         .         .       g.136614
 gatttctcaaatattgtgttcattagtctagactgggaatggggaggggaaatggggaaa       c.*1920

          .         .         .         .         .         .       g.136674
 atgaatgaatgaaatcagaaaaaagtcagcggctcagtaaatacagtttaaagagagaat       c.*1980

          .         .         .         .         .         .       g.136734
 aattacttcagagctacccttttaagagaaaaccatcagaaattgataatgtttatataa       c.*2040

          .         .         .         .         .         .       g.136794
 agtttataaagccattgtgttttgttatataacaaatcagagatgttattttagaatcga       c.*2100

          .         .         .         .         .         .       g.136854
 ttcccatctaaagaactcaattttgagtctgacatttccaggaccagatattgtcttact       c.*2160

          .         .         .         .         .         .       g.136914
 cacatttcctttgctttgaaatagggctttccttccaaatggctatttttaggctaggga       c.*2220

          .         .         .         .         .         .       g.136974
 tgttaacatcagggatttgtgtgtggaataactggaatgtcatttttgcttttaagccat       c.*2280

          .         .         .         .         .         .       g.137034
 ttctgatgatatagccaaagcaggttgtctgactatgtaggatttttacatcttgaaact       c.*2340

          .         .         .         .         .         .       g.137094
 aaatcagaaatccagacatgaaaataacctttctagaatgcctaggagcagaaaacaata       c.*2400

          .         .         .         .         .         .       g.137154
 atagcatgctaaatcacaaatgatgctatgtatgggtatgtaaatatcagtgctgtctgc       c.*2460

          .         .         .         .         .         .       g.137214
 atttctgggtttattgaagacctcttgttgtatatatcctcaaaaattaatgtaattgac       c.*2520

          .         .         .         .         .         .       g.137274
 atcttcaagaatgtttctattgtcttccattcataatcagagatgtaatttgtatggact       c.*2580

          .         .                                               g.137302
 aaataaaaactttattatgtaatgaaaa                                       c.*2608

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Beta 3-glucosyltransferase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center