ubiquitin specific peptidase 9, X-linked (USP9X) - coding DNA reference sequence

(used for variant description)

(last modified June 3, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_001039590.2 in the USP9X gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering USP9X transcript NM_001039590.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5033
                            gcggccgccttagcgcccggtgcttgggtcggc       c.-601

 .         .         .         .         .         .                g.5093
 gccgggagcgaggagcgagctacttcaaagccaccaggcctggagcggggacagaggcgg       c.-541

 .         .         .         .         .         .                g.5153
 cgactaggggaaggtgaagccgtcgctgcaggaggaggagcaggaggaggtgacgcagga       c.-481

 .         .         .         .         .         .                g.5213
 gaaacgcaccgcccggagcccgtctgagctcagcgagagccccagcctgaggggagaagg       c.-421

 .         .         .         .         .         .                g.5273
 ggaagagggccgtcgccggccaaggaggaggaggaggcgggcgcggcgaggagcgagttc       c.-361

 .         .         .         .         .         .                g.5333
 cggcgccggtgtgcagccttttggttgagacgcccgcagccccgagcccggccgccgcag       c.-301

 .         .         .         .         .         .                g.5393
 cctttcgatacactttgttgccggtcacccccgggcctgggatgcacccagggtaggtct       c.-241

 .         .         .         .         .         .                g.5453
 cgtcccgggaccgagccccaccgtcgcctggtgcctcccgcctccgtgtgccctggttgt       c.-181

 .         .         .  | 02      .         .         .             g.42874
 gagaagacgtctgtgtcgtgcg | gttatgcaatggtctctgcaagatggtttattcttgaa    c.-121

 .         .         .         .         .         .                g.42934
 ttggacctttttaagactgacaaatgctggtacttcatcttctataagtggactataatt       c.-61

 .         .         .         .         .         .                g.42994
 tcttttctcaagacaactacataagcagacaaaattgcaaagatctgccctgtgtcgagt       c.-1

          .         .         .         .         .         .       g.43054
 ATGACAGCCACGACTCGTGGCTCTCCGGTCGGAGGGAATGACAACCAGGGCCAGGCTCCT       c.60
 M  T  A  T  T  R  G  S  P  V  G  G  N  D  N  Q  G  Q  A  P         p.20

          .         .         .       | 03 .         .         .    g.48389
 GATGGACAGTCTCAGCCCCCCCTCCAACAGAATCAG | ACTTCATCGCCTGATTCTTCCAAT    c.120
 D  G  Q  S  Q  P  P  L  Q  Q  N  Q   | T  S  S  P  D  S  S  N      p.40

          .         .         .         .         .         .       g.48449
 GAAAATTCCCCGGCAACTCCCCCAGATGAGCAAGGTCAAGGTGATGCCCCACCACAGCTT       c.180
 E  N  S  P  A  T  P  P  D  E  Q  G  Q  G  D  A  P  P  Q  L         p.60

          .         .         .         .         .         .       g.48509
 GAAGATGAGGAACCTGCATTTCCACATACTGACTTGGCCAAGTTGGATGACATGATCAAC       c.240
 E  D  E  E  P  A  F  P  H  T  D  L  A  K  L  D  D  M  I  N         p.80

    | 04     .         .         .         .         .         .    g.50880
 AG | GCCTCGATGGGTGGTTCCAGTTTTGCCGAAAGGGGAATTAGAAGTGCTTTTAGAAGCT    c.300
 R  |  P  R  W  V  V  P  V  L  P  K  G  E  L  E  V  L  L  E  A      p.100

          .         .   | 05     .         .         .         .    g.54128
 GCTATTGATCTTAGTAAAAAGG | GCCTTGATGTTAAAAGTGAAGCATGTCAGCGATTTTTC    c.360
 A  I  D  L  S  K  K  G |   L  D  V  K  S  E  A  C  Q  R  F  F      p.120

          .         .         .         .         .         .       g.54188
 CGTGATGGGCTAACAATATCATTCACTAAAATTCTTACAGATGAAGCAGTGAGTGGCTGG       c.420
 R  D  G  L  T  I  S  F  T  K  I  L  T  D  E  A  V  S  G  W         p.140

          .      | 06  .         .         .         .         .    g.56214
 AAGTTTGAAATTCAT | AGGTGTATTATTAACAATACTCATCGTCTGGTGGAGCTATGTGTG    c.480
 K  F  E  I  H   | R  C  I  I  N  N  T  H  R  L  V  E  L  C  V      p.160

          .         .         .         .         .         .       g.56274
 GCCAAGTTGTCCCAAGACTGGTTTCCACTTTTAGAACTTCTTGCCATGGCCTTAAATCCT       c.540
 A  K  L  S  Q  D  W  F  P  L  L  E  L  L  A  M  A  L  N  P         p.180

          .         .         .         .         .         .       g.56334
 CATTGCAAATTCCATATCTACAATGGTACACGTCCATGTGAATCAGTTTCCTCAAGTGTT       c.600
 H  C  K  F  H  I  Y  N  G  T  R  P  C  E  S  V  S  S  S  V         p.200

          .         .         .         .         .     | 07   .    g.60027
 CAGTTGCCTGAAGATGAACTCTTTGCTCGTTCTCCAGATCCTCGATCACCAAAG | GGTTGG    c.660
 Q  L  P  E  D  E  L  F  A  R  S  P  D  P  R  S  P  K   | G  W      p.220

          .         .         .         .         .         .       g.60087
 CTAGTGGATCTTCTCAACAAATTTGGCACTTTAAATGGGTTCCAGATTTTGCATGATCGT       c.720
 L  V  D  L  L  N  K  F  G  T  L  N  G  F  Q  I  L  H  D  R         p.240

          .         .         .         .         . | 08       .    g.60341
 TTTATTAATGGATCAGCATTAAACGTTCAAATAATTGCAGCCCTTATTAA | ACCATTTGGG    c.780
 F  I  N  G  S  A  L  N  V  Q  I  I  A  A  L  I  K  |  P  F  G      p.260

          .         .         .         .         .         .       g.60401
 CAATGCTATGAGTTTCTCACTCTTCATACAGTGAAAAAGTACTTTCTTCCAATAATAGAA       c.840
 Q  C  Y  E  F  L  T  L  H  T  V  K  K  Y  F  L  P  I  I  E         p.280

          .         .         .         .         .         .       g.60461
 ATGGTTCCACAGTTTTTAGAAAACTTAACTGATGAAGAACTGAAAAAAGAAGCAAAGAAT       c.900
 M  V  P  Q  F  L  E  N  L  T  D  E  E  L  K  K  E  A  K  N         p.300

          .         .         .         .         .         .       g.60521
 GAAGCCAAAAATGATGCTCTTTCAATGATTATTAAATCTTTGAAGAATTTAGCTTCAAGG       c.960
 E  A  K  N  D  A  L  S  M  I  I  K  S  L  K  N  L  A  S  R         p.320

          .         .         .         .         .         .       g.60581
 GTTCCAGGACAAGAAGAAACTGTTAAAAACTTAGAAATATTTAGGTTAAAAATGATACTT       c.1020
 V  P  G  Q  E  E  T  V  K  N  L  E  I  F  R  L  K  M  I  L         p.340

    | 09     .         .         .         .         .         .    g.60716
 AG | ATTATTGCAAATTTCTTCTTTCAATGGAAAGATGAATGCACTGAATGAAGTTAATAAG    c.1080
 R  |  L  L  Q  I  S  S  F  N  G  K  M  N  A  L  N  E  V  N  K      p.360

          .         .         .         .         .         .       g.60776
 GTGATATCTAGTGTATCATACTATACTCATCGACATGGTAATCCTGAGGAGGAAGAGTGG       c.1140
 V  I  S  S  V  S  Y  Y  T  H  R  H  G  N  P  E  E  E  E  W         p.380

          .         .  | 10      .         .         .         .    g.62695
 CTCACAGCTGAACGAATGGCA | GAATGGATACAGCAGAACAATATCTTATCCATAGTGTTG    c.1200
 L  T  A  E  R  M  A   | E  W  I  Q  Q  N  N  I  L  S  I  V  L      p.400

          .         .         .         .         .         .       g.62755
 CGAGATAGTCTTCATCAGCCACAGTATGTAGAAAAGTTAGAGAAGATTCTTCGTTTTGTC       c.1260
 R  D  S  L  H  Q  P  Q  Y  V  E  K  L  E  K  I  L  R  F  V         p.420

          .         .         .         .         .     | 11   .    g.63893
 ATCAAAGAAAAAGCTCTGACCTTACAGGATCTTGATAATATCTGGGCAGCACAG | GCAGGG    c.1320
 I  K  E  K  A  L  T  L  Q  D  L  D  N  I  W  A  A  Q   | A  G      p.440

          .         .         .         .         .         .       g.63953
 AAACATGAAGCCATTGTGAAGAATGTACATGATCTCCTGGCAAAATTGGCATGGGATTTT       c.1380
 K  H  E  A  I  V  K  N  V  H  D  L  L  A  K  L  A  W  D  F         p.460

          .         .         .          | 12        .         .    g.67755
 TCTCCTGAACAACTTGATCATCTTTTTGATTGTTTTAAG | GCCAGTTGGACAAATGCGAGT    c.1440
 S  P  E  Q  L  D  H  L  F  D  C  F  K   | A  S  W  T  N  A  S      p.480

          .         .         .         .         .         .       g.67815
 AAAAAGCAACGTGAAAAGCTACTTGAGCTGATACGTCGTCTTGCAGAAGATGATAAAGAT       c.1500
 K  K  Q  R  E  K  L  L  E  L  I  R  R  L  A  E  D  D  K  D         p.500

          .         .         .         .         .         .       g.67875
 GGTGTGATGGCACACAAAGTGTTGAACCTTCTGTGGAATCTGGCTCACAGTGATGATGTG       c.1560
 G  V  M  A  H  K  V  L  N  L  L  W  N  L  A  H  S  D  D  V         p.520

          .         .         .         .         .         .       g.67935
 CCTGTAGATATCATGGACCTGGCTCTCAGTGCCCACATAAAAATACTAGATTACAGTTGC       c.1620
 P  V  D  I  M  D  L  A  L  S  A  H  I  K  I  L  D  Y  S  C         p.540

        | 13 .         .         .         .         .         .    g.70340
 TCCCAG | GACCGTGATACACAAAAGATCCAATGGATAGATCGCTTTATAGAAGAACTTCGC    c.1680
 S  Q   | D  R  D  T  Q  K  I  Q  W  I  D  R  F  I  E  E  L  R      p.560

          .         .         .         .         .         .       g.70400
 ACAAATGACAAATGGGTTATTCCCGCACTGAAACAAATTAGAGAAATTTGTAGTTTGTTT       c.1740
 T  N  D  K  W  V  I  P  A  L  K  Q  I  R  E  I  C  S  L  F         p.580

          .         .    | 14    .         .         .         .    g.72350
 GGTGAAGCGCCTCAAAATTTGAG | TCAAACTCAGCGAAGTCCCCATGTGTTTTATCGCCAT    c.1800
 G  E  A  P  Q  N  L  S  |  Q  T  Q  R  S  P  H  V  F  Y  R  H      p.600

          .         .         .         .         .         .       g.72410
 GACTTAATCAATCAACTTCAACACAATCATGCCCTAGTTACTTTGGTAGCAGAAAACCTT       c.1860
 D  L  I  N  Q  L  Q  H  N  H  A  L  V  T  L  V  A  E  N  L         p.620

          .         .         .        | 15.         .         .    g.82178
 GCAACTTACATGGAAAGCATGAGACTATATGCTAGAG | ACCATGAAGATTATGACCCACAA    c.1920
 A  T  Y  M  E  S  M  R  L  Y  A  R  D |   H  E  D  Y  D  P  Q      p.640

          .         .         .         .         .         .       g.82238
 ACTGTGAGGCTGGGAAGTAGATATAGTCATGTTCAAGAAGTTCAAGAACGGCTTAACTTC       c.1980
 T  V  R  L  G  S  R  Y  S  H  V  Q  E  V  Q  E  R  L  N  F         p.660

       | 16  .         .         .         .         .         .    g.85292
 CTTAG | ATTTTTATTGAAGGATGGTCAGCTGTGGCTATGTGCTCCTCAGGCAAAACAAATA    c.2040
 L  R  |  F  L  L  K  D  G  Q  L  W  L  C  A  P  Q  A  K  Q  I      p.680

          .         .         .         .         .         .       g.85352
 TGGAAATGCTTAGCTGAGAATGCAGTTTACCTTTGTGATCGTGAAGCCTGTTTTAAGTGG       c.2100
 W  K  C  L  A  E  N  A  V  Y  L  C  D  R  E  A  C  F  K  W         p.700

          .         .         .         .         .         .       g.85412
 TATTCCAAGTTGATGGGGGATGAACCAGACTTAGATCCTGATATTAATAAGGACTTCTTT       c.2160
 Y  S  K  L  M  G  D  E  P  D  L  D  P  D  I  N  K  D  F  F         p.720

          .         .         .         .         .         .       g.85472
 GAAAGTAATGTGCTTCAGCTTGATCCTTCTCTGTTAACTGAAAATGGAATGAAGTGTTTT       c.2220
 E  S  N  V  L  Q  L  D  P  S  L  L  T  E  N  G  M  K  C  F         p.740

          .         .         .         .         .         .       g.85532
 GAGCGATTCTTCAAAGCTGTGAATTGTCGAGAAGGAAAACTAGTAGCAAAAAGGAGAGCC       c.2280
 E  R  F  F  K  A  V  N  C  R  E  G  K  L  V  A  K  R  R  A         p.760

          .         .         .         .         | 17         .    g.86859
 TATATGATGGATGACTTGGAGTTAATAGGATTAGATTACCTTTGGAGG | GTCGTGATTCAG    c.2340
 Y  M  M  D  D  L  E  L  I  G  L  D  Y  L  W  R   | V  V  I  Q      p.780

          .         .         .         .         .         .       g.86919
 AGTAATGATGATATTGCCAGCAGAGCTATAGATCTCCTCAAAGAGATATACACGAACCTT       c.2400
 S  N  D  D  I  A  S  R  A  I  D  L  L  K  E  I  Y  T  N  L         p.800

          .         .     | 18   .         .         .         .    g.87408
 GGTCCAAGACTACAAGTCAATCAG | GTGGTGATCCATGAAGACTTCATTCAGTCTTGTTTT    c.2460
 G  P  R  L  Q  V  N  Q   | V  V  I  H  E  D  F  I  Q  S  C  F      p.820

          .         .         .         .         .         .       g.87468
 GATCGTCTGAAGGCTTCCTATGACACATTGTGTGTTTTGGATGGTGACAAAGACAGTGTT       c.2520
 D  R  L  K  A  S  Y  D  T  L  C  V  L  D  G  D  K  D  S  V         p.840

          .         .         .         .         .         .       g.87528
 AATTGTGCAAGACAGGAAGCTGTTCGAATGGTTCGAGTATTAACTGTTTTAAGGGAATAT       c.2580
 N  C  A  R  Q  E  A  V  R  M  V  R  V  L  T  V  L  R  E  Y         p.860

          .         .         .         .         .       | 19 .    g.89364
 ATAAATGAATGTGACAGTGATTATCATGAGGAAAGAACAATTCTCCCTATGTCGAG | AGCA    c.2640
 I  N  E  C  D  S  D  Y  H  E  E  R  T  I  L  P  M  S  R  |  A      p.880

          .         .         .         .         .         .       g.89424
 TTCCGCGGTAAACACCTCTCTTTTGTAGTTCGATTTCCAAACCAGGGCAGACAGGTTGAT       c.2700
 F  R  G  K  H  L  S  F  V  V  R  F  P  N  Q  G  R  Q  V  D         p.900

          .         .         .         .         .         .       g.89484
 GACTTGGAGGTATGGTCTCATACAAATGATACAATTGGTTCAGTACGACGATGTATTCTC       c.2760
 D  L  E  V  W  S  H  T  N  D  T  I  G  S  V  R  R  C  I  L         p.920

          .         .         .         .         .         .       g.89544
 AATCGTATTAAAGCCAACGTAGCCCATACAAAAATTGAGCTCTTTGTGGGCGGTGAGCTG       c.2820
 N  R  I  K  A  N  V  A  H  T  K  I  E  L  F  V  G  G  E  L         p.940

          .         .         .         .         .        | 20.    g.89838
 ATAGATCCTGCAGATGATAGAAAGTTGATTGGACAATTAAACTTAAAAGATAAATCG | CTT    c.2880
 I  D  P  A  D  D  R  K  L  I  G  Q  L  N  L  K  D  K  S   | L      p.960

          .         .         .         .         .         .       g.89898
 ATTACAGCCAAACTTACACAGATAAGTTCCAATATGCCTTCAAGCCCTGATAGCTCTTCT       c.2940
 I  T  A  K  L  T  Q  I  S  S  N  M  P  S  S  P  D  S  S  S         p.980

          .         .         .         .         .         .       g.89958
 GATTCCTCCACTGGATCTCCTGGAAACCATGGTAATCATTACAGTGATGGTCCCAATCCA       c.3000
 D  S  S  T  G  S  P  G  N  H  G  N  H  Y  S  D  G  P  N  P         p.1000

          .         .        | 21.         .         .         .    g.91236
 GAAGTGGAAAGCTGTTTGCCTGGAGTG | ATAATGTCACTGCATCCCAGATACATCTCTTTT    c.3060
 E  V  E  S  C  L  P  G  V   | I  M  S  L  H  P  R  Y  I  S  F      p.1020

          .         .         .         .         .         .       g.91296
 CTTTGGCAAGTTGCAGACTTAGGTAGCAGCCTAAATATGCCACCCCTTAGAGATGGAGCA       c.3120
 L  W  Q  V  A  D  L  G  S  S  L  N  M  P  P  L  R  D  G  A         p.1040

          .         .         | 22         .         .         .    g.103395
 AGAGTACTTATGAAACTTATGCCGCCAG | ATAGCACAACGATAGAAAAATTAAGAGCTATT    c.3180
 R  V  L  M  K  L  M  P  P  D |   S  T  T  I  E  K  L  R  A  I      p.1060

          .         .         .         .         .         .       g.103455
 TGTTTAGACCATGCCAAACTTGGAGAAAGCAGCCTTAGTCCATCTCTTGACTCACTTTTC       c.3240
 C  L  D  H  A  K  L  G  E  S  S  L  S  P  S  L  D  S  L  F         p.1080

          .         .         .          | 23        .         .    g.103783
 TTTGGTCCTTCAGCCTCACAAGTGCTATATCTAACAGAG | GTAGTCTATGCCTTGTTAATG    c.3300
 F  G  P  S  A  S  Q  V  L  Y  L  T  E   | V  V  Y  A  L  L  M      p.1100

          .         .         .         .         .         .       g.103843
 CCTGCTGGTGCACCTCTGGCTGATGATTCCTCTGATTTTCAGTTTCACTTCTTGAAAAGT       c.3360
 P  A  G  A  P  L  A  D  D  S  S  D  F  Q  F  H  F  L  K  S         p.1120

          .         .         .         .         .         .       g.103903
 GGTGGCCTACCCCTTGTACTGAGTATGCTAACCAGAAATAACTTCCTACCGAATGCAGAT       c.3420
 G  G  L  P  L  V  L  S  M  L  T  R  N  N  F  L  P  N  A  D         p.1140

          .         .         .         .         .         .       g.103963
 ATGGAAACTCGAAGGGGTGCCTACCTCAATGCTCTTAAAATAGCCAAGCTTTTGCTAACT       c.3480
 M  E  T  R  R  G  A  Y  L  N  A  L  K  I  A  K  L  L  L  T         p.1160

          .         .         .         .         .         .       g.104023
 GCCATTGGCTATGGTCATGTTCGAGCTGTGGCAGAAGCTTGTCAGCCAGGTGTAGAAGGT       c.3540
 A  I  G  Y  G  H  V  R  A  V  A  E  A  C  Q  P  G  V  E  G         p.1180

          .         | 24         .         .         .         .    g.105924
 GTGAATCCCATGACACAG | ATCAACCAAGTTACCCATGATCAAGCAGTGGTGCTACAAAGT    c.3600
 V  N  P  M  T  Q   | I  N  Q  V  T  H  D  Q  A  V  V  L  Q  S      p.1200

          .         .         .         .         .         .       g.105984
 GCCCTTCAGAGCATTCCTAATCCATCATCCGAGTGCATGCTTAGAAATGTGTCAGTTCGT       c.3660
 A  L  Q  S  I  P  N  P  S  S  E  C  M  L  R  N  V  S  V  R         p.1220

          .         .     | 25   .         .         .         .    g.107393
 CTTGCTCAGCAGATATCTGATGAG | GCTTCAAGATATATGCCTGATATTTGTGTAATTAGA    c.3720
 L  A  Q  Q  I  S  D  E   | A  S  R  Y  M  P  D  I  C  V  I  R      p.1240

          .         .         .         .         .         .       g.107453
 GCTATACAAAAAATTATCTGGGCATCAGGATGTGGGTCGTTACAGCTAGTATTTAGCCCA       c.3780
 A  I  Q  K  I  I  W  A  S  G  C  G  S  L  Q  L  V  F  S  P         p.1260

          .         .         . | 26       .         .         .    g.108704
 AATGAAGAAATCACTAAAATTTATGAGAAG | ACCAATGCAGGCAATGAGCCAGACTTGGAA    c.3840
 N  E  E  I  T  K  I  Y  E  K   | T  N  A  G  N  E  P  D  L  E      p.1280

          .         .         .         .         .         .       g.108764
 GACGAACAGGTTTGCTGTGAAGCATTGGAAGTGATGACCTTATGTTTTGCCTTGATTCCA       c.3900
 D  E  Q  V  C  C  E  A  L  E  V  M  T  L  C  F  A  L  I  P         p.1300

          .         .         .         .         .         .       g.108824
 ACAGCCTTAGATGCTCTTAGTAAAGAAAAGGCTTGGCAGACATTCATCATTGACTTACTA       c.3960
 T  A  L  D  A  L  S  K  E  K  A  W  Q  T  F  I  I  D  L  L         p.1320

          .        | 27.         .         .         .         .    g.115659
 TTGCACTGTCACAGCAA | AACTGTTCGTCAGGTGGCACAGGAGCAGTTCTTTTTAATGTGC    c.4020
 L  H  C  H  S  K  |  T  V  R  Q  V  A  Q  E  Q  F  F  L  M  C      p.1340

          .         .         .         .         .         .       g.115719
 ACCAGATGTTGCATGGGACACCGGCCTCTACTTTTCTTCATTACTCTACTCTTTACTGTT       c.4080
 T  R  C  C  M  G  H  R  P  L  L  F  F  I  T  L  L  F  T  V         p.1360

        | 28 .         .         .         .         .         .    g.116011
 TTGGGG | AGCACAGCAAGAGAGAGAGCTAAACACTCAGGCGACTACTTTACTCTTTTAAGA    c.4140
 L  G   | S  T  A  R  E  R  A  K  H  S  G  D  Y  F  T  L  L  R      p.1380

          .         .         .         .         .         .       g.116071
 CACCTTCTTAATTACGCTTACAATAGTAATATTAATGTACCCAATGCTGAAGTTCTTCTC       c.4200
 H  L  L  N  Y  A  Y  N  S  N  I  N  V  P  N  A  E  V  L  L         p.1400

          .         .         .    | 29    .         .         .    g.116756
 AATAATGAAATTGATTGGCTTAAAAGAATTAGG | GATGATGTTAAAAGAACAGGAGAAACG    c.4260
 N  N  E  I  D  W  L  K  R  I  R   | D  D  V  K  R  T  G  E  T      p.1420

          .         .         .         .         .         .       g.116816
 GGTATTGAAGAGACGATCTTAGAGGGCCACCTTGGAGTGACAAAGGAGTTACTGGCCTTT       c.4320
 G  I  E  E  T  I  L  E  G  H  L  G  V  T  K  E  L  L  A  F         p.1440

          .         .         .         .         .         .       g.116876
 CAAACTTCTGAGAAAAAATTTCATATTGGTTGTGAAAAAGGAGGTGCTAATCTCATTAAA       c.4380
 Q  T  S  E  K  K  F  H  I  G  C  E  K  G  G  A  N  L  I  K         p.1460

  | 30       .         .         .         .         .         .    g.117953
  | GAATTAATTGATGATTTCATATTTCCTGCATCCAATGTTTACCTACAGTATATGAGAAAT    c.4440
  | E  L  I  D  D  F  I  F  P  A  S  N  V  Y  L  Q  Y  M  R  N      p.1480

          .         .         .         .         .         .       g.118013
 GGAGAGCTTCCAGCTGAACAGGCTATTCCGGTCTGTGGTTCACCACCTACAATTAATGCT       c.4500
 G  E  L  P  A  E  Q  A  I  P  V  C  G  S  P  P  T  I  N  A         p.1500

          .         .         .         .         .         .       g.118073
 GGTTTTGAATTACTTGTAGCATTAGCTGTTGGCTGTGTGAGGAATCTCAAACAAATAGTA       c.4560
 G  F  E  L  L  V  A  L  A  V  G  C  V  R  N  L  K  Q  I  V         p.1520

          .         .         .         .    | 31    .         .    g.120442
 GATTCTTTGACTGAAATGTATTACATTGGCACAGCAATAACTA | CTTGTGAAGCACTTACT    c.4620
 D  S  L  T  E  M  Y  Y  I  G  T  A  I  T  T |   C  E  A  L  T      p.1540

          .         .         .         .         .         .       g.120502
 GAGTGGGAATATCTGCCACCTGTTGGACCCCGCCCACCCAAAGGATTCGTGGGGCTGAAA       c.4680
 E  W  E  Y  L  P  P  V  G  P  R  P  P  K  G  F  V  G  L  K         p.1560

          .         .         .         .         .         .       g.120562
 AATGCCGGTGCTACTTGTTACATGAATTCTGTGATTCAGCAACTCTACATGATTCCTTCC       c.4740
 N  A  G  A  T  C  Y  M  N  S  V  I  Q  Q  L  Y  M  I  P  S         p.1580

          .         .         .         .         .         .       g.120622
 ATTAGGAACGGTATTCTTGCCATTGAAGGCACAGGTAGTGATGTAGATGATGATATGTCT       c.4800
 I  R  N  G  I  L  A  I  E  G  T  G  S  D  V  D  D  D  M  S         p.1600

          .         .     | 32   .         .         .         .    g.124704
 GGGGATGAGAAGCAGGACAATGAG | AGCAATGTTGATCCCAGGGATGATGTATTTGGATAT    c.4860
 G  D  E  K  Q  D  N  E   | S  N  V  D  P  R  D  D  V  F  G  Y      p.1620

          .         .         .         .         .         .       g.124764
 CCTCAACAATTTGAAGATAAACCAGCATTAAGTAAAACTGAAGATAGAAAAGAGTACAAC       c.4920
 P  Q  Q  F  E  D  K  P  A  L  S  K  T  E  D  R  K  E  Y  N         p.1640

          .         .         .         .         .         .       g.124824
 ATTGGTGTCCTAAGACACCTTCAGGTCATCTTTGGTCATTTAGCTGCTTCTCGACTGCAA       c.4980
 I  G  V  L  R  H  L  Q  V  I  F  G  H  L  A  A  S  R  L  Q         p.1660

          .         .         .      | 33  .         .         .    g.129899
 TACTATGTGCCCAGAGGATTTTGGAAACAGTTCAG | GCTTTGGGGTGAGCCTGTTAATCTG    c.5040
 Y  Y  V  P  R  G  F  W  K  Q  F  R  |  L  W  G  E  P  V  N  L      p.1680

          .         .         .         .         .         .       g.129959
 CGTGAACAACACGATGCTTTAGAATTTTTTAATTCATTGGTGGATAGTTTAGATGAAGCT       c.5100
 R  E  Q  H  D  A  L  E  F  F  N  S  L  V  D  S  L  D  E  A         p.1700

          .         .         .         .         .         .       g.130019
 TTAAAAGCTTTAGGACATCCAGCTATGCTAAGTAAAGTCTTAGGAGGTTCCTTTGCTGAT       c.5160
 L  K  A  L  G  H  P  A  M  L  S  K  V  L  G  G  S  F  A  D         p.1720

          .         .          | 34        .         .         .    g.133964
 CAGAAGATCTGCCAAGGCTGCCCACATAG | GTACGAATGTGAAGAATCTTTTACGACCCTA    c.5220
 Q  K  I  C  Q  G  C  P  H  R  |  Y  E  C  E  E  S  F  T  T  L      p.1740

          .         .         .         .         .         .       g.134024
 AACGTAGACATTAGAAATCACCAAAATCTTCTTGATTCTTTGGAACAGTATGTCAAAGGA       c.5280
 N  V  D  I  R  N  H  Q  N  L  L  D  S  L  E  Q  Y  V  K  G         p.1760

          .         .         .         .         .  | 35      .    g.135273
 GATTTACTAGAAGGTGCAAATGCATATCATTGTGAAAAATGCAATAAAAAG | GTTGATACC    c.5340
 D  L  L  E  G  A  N  A  Y  H  C  E  K  C  N  K  K   | V  D  T      p.1780

          .         .         .         .         .         .       g.135333
 GTAAAGCGCTTGCTGATTAAAAAATTACCTCCTGTTCTTGCTATACAACTAAAGCGATTT       c.5400
 V  K  R  L  L  I  K  K  L  P  P  V  L  A  I  Q  L  K  R  F         p.1800

          .         .         .         .         .         .       g.135393
 GACTATGACTGGGAAAGAGAATGTGCAATCAAGTTCAATGATTATTTTGAATTTCCTCGA       c.5460
 D  Y  D  W  E  R  E  C  A  I  K  F  N  D  Y  F  E  F  P  R         p.1820

          .         .         .         .         .         .       g.135453
 GAGCTGGACATGGAACCTTACACAGTTGCAGGTGTCGCAAAGCTGGAAGGGGATAATGTA       c.5520
 E  L  D  M  E  P  Y  T  V  A  G  V  A  K  L  E  G  D  N  V         p.1840

          .         .         .         .         .         .       g.135513
 AACCCAGAGAGTCAGTTGATACAACAGAGTGAGCAGTCTGAAAGTGAGACAGCAGGAAGC       c.5580
 N  P  E  S  Q  L  I  Q  Q  S  E  Q  S  E  S  E  T  A  G  S         p.1860

          .         .         .         .         .         .       g.135573
 ACAAAATACAGACTTGTGGGTGTGCTCGTACACAGTGGTCAAGCGAGTGGGGGGCATTAT       c.5640
 T  K  Y  R  L  V  G  V  L  V  H  S  G  Q  A  S  G  G  H  Y         p.1880

          .         .         .         .         .         .       g.135633
 TATTCTTACATCATCCAAAGGAATGGTGGAGATGGTGAGAGAAATCGCTGGTATAAATTT       c.5700
 Y  S  Y  I  I  Q  R  N  G  G  D  G  E  R  N  R  W  Y  K  F         p.1900

          .         .         .         .         .         .       g.135693
 GATGATGGTGATGTAACAGAATGTAAAATGGATGATGACGAAGAAATGAAAAACCAGTGT       c.5760
 D  D  G  D  V  T  E  C  K  M  D  D  D  E  E  M  K  N  Q  C         p.1920

          .         .         .         .         .         .       g.135753
 TTTGGTGGAGAGTACATGGGAGAAGTGTTTGATCACATGATGAAGCGTATGTCATACAGG       c.5820
 F  G  G  E  Y  M  G  E  V  F  D  H  M  M  K  R  M  S  Y  R         p.1940

          .         .         .         .         .         .       g.135813
 CGCCAGAAAAGGTGGTGGAATGCTTATATACTTTTTTATGAACGAATGGACACAATAGAC       c.5880
 R  Q  K  R  W  W  N  A  Y  I  L  F  Y  E  R  M  D  T  I  D         p.1960

          .         .         .         .         .         .       g.135873
 CAAGATGATGAGTTGATAAGATATATATCAGAGCTTGCTATCACCACCAGACCTCATCAG       c.5940
 Q  D  D  E  L  I  R  Y  I  S  E  L  A  I  T  T  R  P  H  Q         p.1980

          .         .         .         .         .         .       g.135933
 ATTATTATGCCATCAGCCATTGAGAGAAGTGTACGGAAACAGAACGTACAATTCATGCAT       c.6000
 I  I  M  P  S  A  I  E  R  S  V  R  K  Q  N  V  Q  F  M  H         p.2000

          .         .         .         .         .         .       g.135993
 AACCGAATGCAGTACAGTATGGAGTATTTTCAGTTTATGAAAAAACTGCTTACATGTAAT       c.6060
 N  R  M  Q  Y  S  M  E  Y  F  Q  F  M  K  K  L  L  T  C  N         p.2020

          .         .      | 36  .         .         .         .    g.136620
 GGCGTTTACTTAAACCCTCCTCCCG | GGCAAGATCACCTGTTGCCTGAAGCAGAAGAAATC    c.6120
 G  V  Y  L  N  P  P  P  G |   Q  D  H  L  L  P  E  A  E  E  I      p.2040

          .         .         .         .         .         .       g.136680
 ACTATGATCAGTATTCAACTTGCTGCTAGGTTCCTCTTTACTACAGGATTTCACACAAAG       c.6180
 T  M  I  S  I  Q  L  A  A  R  F  L  F  T  T  G  F  H  T  K         p.2060

          .         .          | 37        .         .         .    g.137768
 AAAGTAGTCCGTGGCTCTGCCAGTGATTG | GTATGATGCATTGTGTATTCTCCTTCGTCAC    c.6240
 K  V  V  R  G  S  A  S  D  W  |  Y  D  A  L  C  I  L  L  R  H      p.2080

          .         .         .         .         .         .       g.137828
 AGCAAGAATGTACGTTTTTGGTTTGCTCATAACGTCCTTTTTAATGTTTCAAATCGCTTC       c.6300
 S  K  N  V  R  F  W  F  A  H  N  V  L  F  N  V  S  N  R  F         p.2100

          .         .         .         .         .         .       g.137888
 TCCGAATACCTTCTGGAGTGCCCTAGTGCAGAAGTGAGGGGTGCGTTTGCAAAACTTATA       c.6360
 S  E  Y  L  L  E  C  P  S  A  E  V  R  G  A  F  A  K  L  I         p.2120

          .         .         .         .         .         .       g.137948
 GTCTTTATTGCACATTTTTCCTTGCAAGATGGGCCATGTCCTTCACCTTTTGCCTCTCCT       c.6420
 V  F  I  A  H  F  S  L  Q  D  G  P  C  P  S  P  F  A  S  P         p.2140

          .      | 38  .         .         .         .         .    g.138512
 GGACCTTCTAGTCAG | GCTTATGACAACTTAAGCTTGAGTGATCACTTACTAAGAGCAGTA    c.6480
 G  P  S  S  Q   | A  Y  D  N  L  S  L  S  D  H  L  L  R  A  V      p.2160

          .         .         .         .         .         .       g.138572
 CTAAATCTCTTGAGAAGGGAAGTTTCAGAGCATGGGCGTCATTTACAGCAGTATTTCAAC       c.6540
 L  N  L  L  R  R  E  V  S  E  H  G  R  H  L  Q  Q  Y  F  N         p.2180

          .         .      | 39  .         .         .         .    g.142617
 CTGTTTGTAATGTATGCCAATTTAG | GTGTGGCAGAGAAGACACAGCTTCTGAAATTGAGT    c.6600
 L  F  V  M  Y  A  N  L  G |   V  A  E  K  T  Q  L  L  K  L  S      p.2200

          .         .         .         .         .         .       g.142677
 GTACCTGCTACTTTTATGCTTGTGTCTTTAGATGAAGGTCCAGGTCCTCCAATCAAATAC       c.6660
 V  P  A  T  F  M  L  V  S  L  D  E  G  P  G  P  P  I  K  Y         p.2220

          .         .         .         .         .         .       g.142737
 CAGTATGCTGAATTAGGCAAATTATACTCAGTAGTGTCACAGCTGATCCGCTGTTGCAAT       c.6720
 Q  Y  A  E  L  G  K  L  Y  S  V  V  S  Q  L  I  R  C  C  N         p.2240

          .         .         .  | 40      .         .         .    g.144136
 GTCTCTTCAAGAATGCAGTCTTCAATCAATG | GTAATCCTCCTCTTCCCAATCCTTTTGGT    c.6780
 V  S  S  R  M  Q  S  S  I  N  G |   N  P  P  L  P  N  P  F  G      p.2260

          .         .         .         .         .         .       g.144196
 GATCCTAATTTATCACAACCTATAATGCCAATTCAGCAGAATGTGGCAGACATTTTATTT       c.6840
 D  P  N  L  S  Q  P  I  M  P  I  Q  Q  N  V  A  D  I  L  F         p.2280

          .         .         .         .         .         .       g.144256
 GTGAGAACAAGTTATGTGAAGAAAATCATTGAAGACTGCAGTAATTCAGAGGAAACCGTC       c.6900
 V  R  T  S  Y  V  K  K  I  I  E  D  C  S  N  S  E  E  T  V         p.2300

          .         .         .         .         .         .       g.144316
 AAATTGCTTCGTTTTTGCTGCTGGGAGAATCCTCAGTTCTCATCTACTGTCCTCAGTGAA       c.6960
 K  L  L  R  F  C  C  W  E  N  P  Q  F  S  S  T  V  L  S  E         p.2320

          .   | 41     .         .         .         .         .    g.144462
 CTTCTCTGGCAG | GTTGCATATTCCTATACCTATGAACTGCGGCCCTATTTGGATCTGCTT    c.7020
 L  L  W  Q   | V  A  Y  S  Y  T  Y  E  L  R  P  Y  L  D  L  L      p.2340

          .         .         .         .  | 42      .         .    g.148637
 TTGCAAATCTTACTGATTGAGGACTCCTGGCAAACTCACAG | AATTCATAATGCACTGAAA    c.7080
 L  Q  I  L  L  I  E  D  S  W  Q  T  H  R  |  I  H  N  A  L  K      p.2360

          .         .         .         .         .         .       g.148697
 GGAATTCCAGATGACCGAGATGGGCTGTTTGACACAATCCAGCGCTCTAAGAATCACTAT       c.7140
 G  I  P  D  D  R  D  G  L  F  D  T  I  Q  R  S  K  N  H  Y         p.2380

          .         .         .         .         .         .       g.148757
 CAAAAAAGAGCATACCAGTGTATAAAATGTATGGTAGCTCTATTTAGTAACTGTCCTGTT       c.7200
 Q  K  R  A  Y  Q  C  I  K  C  M  V  A  L  F  S  N  C  P  V         p.2400

          .         | 43         .         .         .         .    g.148974
 GCTTACCAAATCCTGCAG | GGCAATGGAGATCTTAAAAGAAAGTGGACCTGGGCAGTGGAA    c.7260
 A  Y  Q  I  L  Q   | G  N  G  D  L  K  R  K  W  T  W  A  V  E      p.2420

          .         .         .         .         .         .       g.149034
 TGGCTTGGAGATGAACTTGAAAGAAGACCATATACTGGCAATCCTCAGTACACTTACAAC       c.7320
 W  L  G  D  E  L  E  R  R  P  Y  T  G  N  P  Q  Y  T  Y  N         p.2440

          .         .         .         .         .         .       g.149094
 AATTGGTCTCCCCCAGTGCAAAGCAATGAAACGTCCAATGGTTATTTCTTGGAGAGATCA       c.7380
 N  W  S  P  P  V  Q  S  N  E  T  S  N  G  Y  F  L  E  R  S         p.2460

          .         .         .         .         .         .       g.149154
 CATAGTGCTAGGATGACACTTGCAAAAGCTTGTGAACTCTGTCCAGAGGAGGTAAAAAAA       c.7440
 H  S  A  R  M  T  L  A  K  A  C  E  L  C  P  E  E  V  K  K         p.2480

          .         .         .          | 44        .         .    g.149887
 GCCACCAGTGTGCAGCAGATAGAAATGGAAGAGAGCAAA | GAGCCAGATGACCAAGATGCT    c.7500
 A  T  S  V  Q  Q  I  E  M  E  E  S  K   | E  P  D  D  Q  D  A      p.2500

          .         .         .         .         .         .       g.149947
 CCAGATGAACATGAGTCGCCTCCACCTGAAGATGCCCCATTGTACCCCCATTCACCTGGA       c.7560
 P  D  E  H  E  S  P  P  P  E  D  A  P  L  Y  P  H  S  P  G         p.2520

          .      | 45  .         .         .         .         .    g.151797
 TCTCAGTATCAACAG | AATAACCATGTGCATGGACAGCCATATACAGGCCCAGCAGCACAT    c.7620
 S  Q  Y  Q  Q   | N  N  H  V  H  G  Q  P  Y  T  G  P  A  A  H      p.2540

          .         .         .         .         .         .       g.151857
 CACATGAACAACCCTCAGAGAACTGGCCAACGAGCACAAGAAAATTATGAAGGCAGTGAA       c.7680
 H  M  N  N  P  Q  R  T  G  Q  R  A  Q  E  N  Y  E  G  S  E         p.2560

          .         .         .                                     g.151890
 GAAGTATCCCCACCTCAAACCAAGGATCAATGA                                  c.7713
 E  V  S  P  P  Q  T  K  D  Q  X                                    p.2570

          .         .         .         .         .         .       g.151950
 aatgcacataattaactggttccatcaagactgtgcacccaggccttacagtccaacctt       c.*60

          .         .         .         .         .         .       g.152010
 tttctgtgtctggctaatatttaaaactagaaaaactattcctaatcaacatggagtgga       c.*120

          .         .         .         .         .         .       g.152070
 gagtttattcactgtcttatctgcagaaatttgctgtcaatatataacccgcctgcagtg       c.*180

          .         .         .         .         .         .       g.152130
 gaaagtgtatagtgttttgtaataaatggcctgatgctaatgtgtaaatggcaaaggtgt       c.*240

          .         .         .         .         .         .       g.152190
 atatagtatattaatgttgactgttaattcttaagcaagaaacttttttcttgatgagac       c.*300

          .         .         .         .         .         .       g.152250
 tcacagatctacacaaactacaaaagttaattttcttgttacacccactgcactctgcaa       c.*360

          .         .         .         .         .         .       g.152310
 ccagtgttgcctgcctcatggcagttggatcagctcctttacaaaaaagaaaaaaaaaaa       c.*420

          .         .         .         .         .         .       g.152370
 accaacagcaacaaaacagagcccatccatgtcagccacaccaatagtttcatgttaatt       c.*480

          .         .         .         .         .         .       g.152430
 ctttgccactggagtcaattttgctatgagcaatgtaaggctggtaacctttaaattatt       c.*540

          .         .         .         .         .         .       g.152490
 tggttgatgtggaaaattggtgatgtaacactgtttctagatttttttcattgccttttt       c.*600

          .         .         .         .         .         .       g.152550
 attctgatattaggttaatcactttgaagctatagttatgctgtaacatttagcatggct       c.*660

          .         .         .         .         .         .       g.152610
 tcacaccaagttagtgtagccaatgaggaaaaagttaccataatgacagcagttgtccga       c.*720

          .         .         .         .         .         .       g.152670
 gaagtgacagctgtattactcagagcttttacttcttacacctagaatattaaaatataa       c.*780

          .         .         .         .         .         .       g.152730
 aacaaggggagaaatgtgacagtctattttcagttgcacatatgttccttatatataatg       c.*840

          .         .         .         .         .         .       g.152790
 tttgacagttcaatctctgggtggaataaagaacacttacgtatcagtaatgggaatttt       c.*900

          .         .         .         .         .         .       g.152850
 taaagatttaaaacaaatatgcaaaaatttgctatgccaagatgctggagcataatataa       c.*960

          .         .         .         .         .         .       g.152910
 gactgtatttggtgtgcttgttttgtttctttggtagagtttattaggtgaatcttctaa       c.*1020

          .         .         .         .         .         .       g.152970
 aactttccttctgttggatcccagtgacgtggaagtcatcagaaccccacggtacttgga       c.*1080

          .         .         .         .         .         .       g.153030
 gtacctctctgcaccaagatagctggctgattttctgctcagtcacaattttacttgaaa       c.*1140

          .         .         .         .         .         .       g.153090
 gcaagaattgtcctagctccttttccattattccaaaacgtttaacgttcaaagcagggt       c.*1200

          .         .         .         .         .         .       g.153150
 ctcattaaaaaagaaactactggttgatataattgagatattacaatttcagaataaaca       c.*1260

          .         .         .         .         .         .       g.153210
 tttgattaaaaataaggaaatcctcagttcatactgtatttaaaagagaattggtaactt       c.*1320

          .         .         .         .         .         .       g.153270
 gaatgtgtgtaattttttggaacctgtctaaaaaccaaatacccctgcaaacagatacag       c.*1380

          .         .         .         .         .         .       g.153330
 cccaccctattctatttaaatattttgctgttttattttatagaaattattttgctgaat       c.*1440

          .         .         .         .         .         .       g.153390
 tcacaaatagaatttgatttaagaagaactttttgtcctgtggtgtgtttttggtttttt       c.*1500

          .         .         .         .         .         .       g.153450
 ttttggttactttttttgtcctttttttttttttttaaaagaggactgcatattaaaatt       c.*1560

          .         .         .         .         .         .       g.153510
 cattctgtgcatagcatgcctaggcatgacactgattcaggatttcagtcacatcaagtt       c.*1620

          .         .         .         .         .         .       g.153570
 tttgtgcacagaaagatttgacctttggccctctactgaagattttgagaaatcaggatg       c.*1680

          .         .         .         .         .         .       g.153630
 ttgacactgtaaaagtttcctaacataatcttgtactttttgtatgttttttatatacat       c.*1740

          .         .         .         .         .         .       g.153690
 gtatatttaatgagcacaagcttggttgtattttttacaattcagttaatagggaaatgt       c.*1800

          .         .         .         .         .         .       g.153750
 tttgtcaaaaggctacacttggaactgaacaaagcagaaacaaaattgagcattgcatta       c.*1860

          .         .         .         .         .         .       g.153810
 ttttgtgattaaaaggggcaggtatttaagataaagctttgggtatcttatttgtagtac       c.*1920

          .         .         .         .         .         .       g.153870
 tgtatagtcaacctgtgcttctaggtgttcctgtaggacattttgacaccgatactttga       c.*1980

          .         .         .         .         .         .       g.153930
 gtgaaagtcacacacggtgtttgcaattccaactgatttttgttttgtttttattttttt       c.*2040

          .         .         .         .         .         .       g.153990
 gttgttttcttctttgagatggagtcttgctctgtcacccaggctggagtgcagtggcac       c.*2100

          .         .         .         .         .         .       g.154050
 aatcttggctcactgcaacgtcgcctcctgggttcaagcgattcttccgcctcagcctcc       c.*2160

          .         .         .         .         .         .       g.154110
 cgagtagctgggattagaggtgcccaccaccacgcccagctaatttttgtatttttgtag       c.*2220

          .         .         .         .         .         .       g.154170
 agacagggtttcaccacgttggccaggctggtcttgaactcctgacctcaggtgatctgg       c.*2280

          .         .         .         .         .         .       g.154230
 ccgcctcggcctcccaaagtgctgggattgcaggtgtgagccaccgcgcctggccccagt       c.*2340

          .         .         .         .         .         .       g.154290
 tgatagtttttttaatttaaaagttcctcaattccaagctctttaaacgagtgaaatagg       c.*2400

          .         .         .         .         .         .       g.154350
 ttaactttatttggatgagttaggtgtaccatctcaccatctgagaggagatttatatat       c.*2460

          .         .         .         .         .         .       g.154410
 ttcctgctgctccttaacaaaatatgtaatgtacttaaaaactttaacgacttcctagtt       c.*2520

          .         .         .         .         .         .       g.154470
 gagagaaaacttgacatataaaaggctgtgaatttttctgcttggaggaagagcccaacc       c.*2580

          .         .         .         .         .         .       g.154530
 ttggttgctttgaagttacaagcccccttgtgccaggtgaggggcttgtgagtcattttt       c.*2640

          .         .         .         .         .         .       g.154590
 gtctccatttgaggaagagtggtattcgttgtgactaggagcaagggaaagtggagttat       c.*2700

          .         .         .         .         .         .       g.154650
 ttttgtttgtgcaaattattttctatatttaactcaagcattaatgtataaccagaaatt       c.*2760

          .         .         .         .         .         .       g.154710
 taaagatgcatgttgttgcaagagcaacataatggtgattttgaggtctttttctgaaca       c.*2820

          .         .         .         .         .         .       g.154770
 caagtggcacattttaaatttcaagtcttcaaagtgcctaaggattatttagttctccct       c.*2880

          .         .         .         .         .         .       g.154830
 caactgattttttgagccatatatttcctattttaaatgtttgcggaatcgccagtcttc       c.*2940

          .         .         .         .         .         .       g.154890
 ctttgaaagaaacagcccccagaattctaaatgacacgattatagaagacagtagaatgt       c.*3000

          .         .         .         .         .         .       g.154950
 gttaccataaagactgaagatattttagttgtaaaaccatgtgaacaagggcttttgccc       c.*3060

          .         .         .         .         .         .       g.155010
 tattgtatctaagtatttcagtgcacaacttgttaaaccatgttgctgctgtttctaagc       c.*3120

          .         .         .         .         .         .       g.155070
 cctccaccaactgaactttcatgtttagcattgtagaggcagaaataacatactaggttt       c.*3180

          .         .         .         .         .         .       g.155130
 tttttttctttcattgatttttctcctggtgataatttcccagccttgtgtcttttagct       c.*3240

          .         .         .         .         .         .       g.155190
 gttgtgtatacaaatttagaattaaaatgttttctatttttttcatgattaacttagtga       c.*3300

          .         .         .         .         .         .       g.155250
 ataacttaaatccttaatcctcgtagtggttagaaagatgaggagacttttttgacttac       c.*3360

          .         .         .         .         .         .       g.155310
 atttgtaaatgaaaacaagtctgtgaatattcagatgactacttcgaagtaattcagttt       c.*3420

          .         .         .         .         .         .       g.155370
 ttttattagtatttttccagcttatgttttcccatgagctattttactttgctgaatttt       c.*3480

          .         .         .         .         .         .       g.155430
 gtgggtaatttggtggatatatcctgccttatttaggattatagctggataagaaaattg       c.*3540

          .         .         .         .         .         .       g.155490
 ccttttcattgtaagtgcccagttttggtctctagtttgaaggtactacatactgccgat       c.*3600

          .         .         .         .         .         .       g.155550
 aaaggaaaacactcccctacaccccagtttttgtgttaccaagaaaaaaaaaacagtatt       c.*3660

          .         .         .         .         .         .       g.155610
 ggtttcatagtaggactcaaccagaattggtcctacatatatgtgagtgttcagtttttg       c.*3720

          .         .         .         .         .         .       g.155670
 caaataaggtttttgagtgtgataaaacactacagaagtgctaagtgtattgagaatttg       c.*3780

          .         .         .         .         .         .       g.155730
 ctgctgattgtatttataacaattacttgacgtttgcagaaatttagcactttccctcca       c.*3840

          .         .         .         .         .         .       g.155790
 aatttataggtgtaagagaagcgggggcaaggtgcaccacattttaaaactgcaaatgtg       c.*3900

          .         .         .         .         .         .       g.155850
 tgaaaatttatttagagattcagattcctaaaaggaaatttcaccacccaagtcatgcac       c.*3960

          .         .         .         .         .         .       g.155910
 ttcttagccttttacaagccaacagactgacatgaagattgttcacagttcctaagattt       c.*4020

          .         .         .                                     g.155945
 agcacatatacaaaaataaaactttataaattcaa                                c.*4055

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Ubiquitin specific peptidase 9, X-linked protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 10b
©2004-2014 Leiden University Medical Center