Hermansky-Pudlak syndrome 5 (HPS5) - coding DNA reference sequence

(used for variant description)

(last modified July 25, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_181507.1 in the HPS5 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008877.1, covering HPS5 transcript NM_181507.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5038
                       cgcgaggggagactgaagttcacgttccgctcttagtg       c.-241

 .         .         .         .         .         .                g.5098
 cgcggtgagttccccggcgctaagccgggagacaagatccgatctactgagagctgcgag       c.-181

 .         .         .         .         .         .                g.5158
 gtactgccctggatgtggtggagctgggctgggacctccgggctgctggtctgtgagcct       c.-121

 .         .         .         .         .         .                g.5218
 ggctttgaaaattggttactgggtctcctctcaagaaatctcaagatattaaagttactg       c.-61

 .         . | 02       .         .         .         .             g.9316
 ctgttaaaaag | gtgaggaatactgtatctatcattcaacaagtttcagctttctggctaa    c.-1

          .         .         .         .         .         .       g.9376
 ATGGCTTTTGTGCCAGTGATACCAGAGTCCTACAGCCATGTTCTTGCAGAGTTTGAATCT       c.60
 M  A  F  V  P  V  I  P  E  S  Y  S  H  V  L  A  E  F  E  S         p.20

          .         .         .         .         | 03         .    g.15162
 CTGGATCCATTACTCTCAGCCCTGCGGCTGGACTCCAGTCGTCTAAAG | TGCACGAGCATA    c.120
 L  D  P  L  L  S  A  L  R  L  D  S  S  R  L  K   | C  T  S  I      p.40

          .         .         .         .         .         .       g.15222
 GCTGTGTCTCGGAAATGGTTGGCTTTGGGCAGTTCAGGAGGAGGACTCCATCTCATTCAG       c.180
 A  V  S  R  K  W  L  A  L  G  S  S  G  G  G  L  H  L  I  Q         p.60

          .         .         .          | 04        .         .    g.15744
 AAAGAAGGCTGGAAGCACAGGCTTTTTCTTTCACACAGG | GAAGGTGCAATTTCTCAAGTC    c.240
 K  E  G  W  K  H  R  L  F  L  S  H  R   | E  G  A  I  S  Q  V      p.80

          .         .         .         .     | 05   .         .    g.16257
 GCCTGTTGTTTACATGATGATGATTATGTTGCTGTAGCTACCAG | TCAAGGTCTTGTGGTT    c.300
 A  C  C  L  H  D  D  D  Y  V  A  V  A  T  S  |  Q  G  L  V  V      p.100

          .         .         .         .         .         .       g.16317
 GTTTGGGAATTAAATCAAGAGCGTCGTGGGAAACCGGAACAAATGTATGTGTCTTCAGAA       c.360
 V  W  E  L  N  Q  E  R  R  G  K  P  E  Q  M  Y  V  S  S  E         p.120

          .         .         .         .         .         .       g.16377
 CACAAAGGCCGAAGAGTCACAGCTCTCTGCTGGGATACAGCTATTCTTAGAGTTTTTGTA       c.420
 H  K  G  R  R  V  T  A  L  C  W  D  T  A  I  L  R  V  F  V         p.140

          .         .         .         .         .        | 06.    g.18098
 GGTGATCATGCTGGGAAGGTTTCTGCTATCAAACTCAATACTTCTAAACAAGCAAAG | GCA    c.480
 G  D  H  A  G  K  V  S  A  I  K  L  N  T  S  K  Q  A  K   | A      p.160

          .         .         .         .         .         .       g.18158
 GCTGCTGCTTTTGTGATGTTTCCTGTTCAGACAATCACAACTGTTGACTCCTGTGTTGTA       c.540
 A  A  A  F  V  M  F  P  V  Q  T  I  T  T  V  D  S  C  V  V         p.180

          .         .         .         .         .         .       g.18218
 CAGTTAGATTATTTGGATGGAAGGCTACTTATATCTTCACTTACTCGATCCTTCTTGTGT       c.600
 Q  L  D  Y  L  D  G  R  L  L  I  S  S  L  T  R  S  F  L  C         p.200

          .  | 07      .         .         .         .         .    g.20876
 GACACTGAGAG | AGAAAAGTTTTGGAAAATTGGAAACAAGGAAAGAGATGGAGAATATGGA    c.660
 D  T  E  R  |  E  K  F  W  K  I  G  N  K  E  R  D  G  E  Y  G      p.220

          .         .         .         .         .         .       g.20936
 GCTTGTTTCTTTCCTGGAAGATGTTCTGGGGGCCAGCAACCTCTGATATATTGTGCTCGC       c.720
 A  C  F  F  P  G  R  C  S  G  G  Q  Q  P  L  I  Y  C  A  R         p.240

          .         .         .         .         .         .       g.20996
 CCAGGCTCTAGGATGTGGGAAGTGAACTTTGATGGAGAAGTTATAAGTACACATCAGTTC       c.780
 P  G  S  R  M  W  E  V  N  F  D  G  E  V  I  S  T  H  Q  F         p.260

          .         .         .         .     | 08   .         .    g.21697
 AAGAAACTCCTCTCGTTGCCACCTCTCCCTGTGATTACTCTCAG | ATCAGAACCTCAGTAT    c.840
 K  K  L  L  S  L  P  P  L  P  V  I  T  L  R  |  S  E  P  Q  Y      p.280

          .         .         .         .         .       | 09 .    g.26262
 GATCATACAGCTGGATCCTCCCAGTCTTTGTCTTTCCCCAAACTCTTACATCTTAG | TGAG    c.900
 D  H  T  A  G  S  S  Q  S  L  S  F  P  K  L  L  H  L  S  |  E      p.300

          .         .         .         .         .         .       g.26322
 CATTGTGTGCTGACTTGGACAGAAAGAGGAATTTATATTTTCATTCCTCAGAATGTTCAA       c.960
 H  C  V  L  T  W  T  E  R  G  I  Y  I  F  I  P  Q  N  V  Q         p.320

          .         .      | 10  .         .         .         .    g.28239
 GTTCTTCTTTGGAGTGAAGTCAAAG | ATATTCAGGATGTGGCTGTCTGTAGGAATGAATTG    c.1020
 V  L  L  W  S  E  V  K  D |   I  Q  D  V  A  V  C  R  N  E  L      p.340

          .         .         .         .         .         .       g.28299
 TTCTGTTTGCACCTAAATGGGAAAGTCTCACATCTCTCCCTGATATCTGTGGAGCGCTGT       c.1080
 F  C  L  H  L  N  G  K  V  S  H  L  S  L  I  S  V  E  R  C         p.360

          .         .         .         .         .         .       g.28359
 GTGGAACGCCTGCTAAGAAGAGGCCTATGGAACTTGGCTGCTCGTACATGCTGTCTTTTC       c.1140
 V  E  R  L  L  R  R  G  L  W  N  L  A  A  R  T  C  C  L  F         p.380

          .         .     | 11   .         .         .         .    g.29493
 CAAAATTCTGTCATTGCCAGCAGA | GCAAGAAAAACTTTGACTGCAGATAAATTGGAGCAT    c.1200
 Q  N  S  V  I  A  S  R   | A  R  K  T  L  T  A  D  K  L  E  H      p.400

          .         .         .         .         .         .       g.29553
 TTGAAATCTCAGCTGGACCATGGCACCTACAATGATCTAATTTCTCAACTGGAAGAATTG       c.1260
 L  K  S  Q  L  D  H  G  T  Y  N  D  L  I  S  Q  L  E  E  L         p.420

          .         .         .         .         .         .       g.29613
 ATCTTAAAATTTGAACCTTTGGATTCAGCTTGTAGCAGTAGAAGAAGCTCCATTTCATCA       c.1320
 I  L  K  F  E  P  L  D  S  A  C  S  S  R  R  S  S  I  S  S         p.440

     | 12    .         .         .         .         .         .    g.30247
 CAT | GAAAGTTTCAGCATCTTGGACTCTGGTATTTATCGTATCATTAGTAGTAGAAGAGGC    c.1380
 H   | E  S  F  S  I  L  D  S  G  I  Y  R  I  I  S  S  R  R  G      p.460

          .         .         .         .         .         .       g.30307
 AGTCAGTCAGATGAAGACTCTTGCTCCCTTCACAGCCAAACCCTCTCAGAAGATGAGAGA       c.1440
 S  Q  S  D  E  D  S  C  S  L  H  S  Q  T  L  S  E  D  E  R         p.480

          .         .         .         .         .         .       g.30367
 TTTAAAGAATTCACCTCACAGCAGGAAGAGGACCTGCCAGATCAGTGTTGTGGCTCACAC       c.1500
 F  K  E  F  T  S  Q  Q  E  E  D  L  P  D  Q  C  C  G  S  H         p.500

          . | 13       .         .         .         .         .    g.31102
 GGAAATGAAG | ACAATGTTTCTCATGCTCCAGTGATGTTTGAGACAGATAAGAATGAAACT    c.1560
 G  N  E  D |   N  V  S  H  A  P  V  M  F  E  T  D  K  N  E  T      p.520

          .         .         .         .         .         .       g.31162
 TTTCTCCCGTTCGGCATTCCATTACCATTTCGTTCTCCATCTCCTCTTGTGTCTCTTCAG       c.1620
 F  L  P  F  G  I  P  L  P  F  R  S  P  S  P  L  V  S  L  Q         p.540

          .     | 14   .         .         .         .         .    g.32051
 GCTGTCAAAGAAAG | TGTTTCTAGCTTTGTGCGTAAAACTACTGAGAAGATTGGCACCCTT    c.1680
 A  V  K  E  S  |  V  S  S  F  V  R  K  T  T  E  K  I  G  T  L      p.560

          .         .         .         .         .         .       g.32111
 CACACGAGCCCTGATCTGAAAGTGAGACCAGAGCTCAGGGGTGATGAGCAATCATGTGAA       c.1740
 H  T  S  P  D  L  K  V  R  P  E  L  R  G  D  E  Q  S  C  E         p.580

          .         .         .         .     | 15   .         .    g.34214
 GAGGATGTGAGTTCAGATACCTGCCCAAAGGAGGAAGACACTGA | GGAGGAAAAAGAGGTA    c.1800
 E  D  V  S  S  D  T  C  P  K  E  E  D  T  E  |  E  E  K  E  V      p.600

          .         .         .         .         .         .       g.34274
 ACTAGTCCACCTCCAGAAGAAGACAGGTTCCAGGAGCTTAAAGTAGCAACAGCAGAAGCA       c.1860
 T  S  P  P  P  E  E  D  R  F  Q  E  L  K  V  A  T  A  E  A         p.620

    | 16     .         .         .         .         .         .    g.35213
 AT | GACCAAGCTACAGGACCCTCTGGTTTTATTTGAATCCGAGTCTCTGAGAATGGTTTTA    c.1920
 M  |  T  K  L  Q  D  P  L  V  L  F  E  S  E  S  L  R  M  V  L      p.640

          .         .         .         .         .         .       g.35273
 CAGGAGTGGCTTTCACATTTAGAAAAAACATTTGCCATGAAGGACTTTTCAGGTGTTTCA       c.1980
 Q  E  W  L  S  H  L  E  K  T  F  A  M  K  D  F  S  G  V  S         p.660

          .         .         .         .         .         .       g.35333
 GATACTGACAACTCATCCATGAAATTGAACCAGGATGTGCTATTAGTTAATGAATCAAAA       c.2040
 D  T  D  N  S  S  M  K  L  N  Q  D  V  L  L  V  N  E  S  K         p.680

          .         .         .         .         .         .       g.35393
 AAGGGAATATTAGATGAAGATAATGAAAAAGAAAAAAGGGACTCTTTAGGCAATGAAGAA       c.2100
 K  G  I  L  D  E  D  N  E  K  E  K  R  D  S  L  G  N  E  E         p.700

          .         .         .         .         .         .       g.35453
 TCTGTTGATAAAACAGCATGTGAATGTGTAAGGAGTCCAAGGGAGTCTTTGGATGACCTG       c.2160
 S  V  D  K  T  A  C  E  C  V  R  S  P  R  E  S  L  D  D  L         p.720

          .         .         .         .         .         .       g.35513
 TTTCAAATATGTTCTCCATGCGCCATTGCAAGTGGTCTTCGGAACGACCTGGCTGAATTG       c.2220
 F  Q  I  C  S  P  C  A  I  A  S  G  L  R  N  D  L  A  E  L         p.740

          .         .         .         .         .         .       g.35573
 ACAACATTATGTTTGGAGTTGAATGTATTGAATTCTAAGATCAAAAGCACCAGTGGACAT       c.2280
 T  T  L  C  L  E  L  N  V  L  N  S  K  I  K  S  T  S  G  H         p.760

          .         .         .         .         .         .       g.35633
 GTGGACCACACTTTGCAACAGTACTCTCCTGAAATTCTGGCTTGCCAGTTCCTGAAGAAG       c.2340
 V  D  H  T  L  Q  Q  Y  S  P  E  I  L  A  C  Q  F  L  K  K         p.780

          .         .         .         .         .         .       g.35693
 TACTTTTTTCTCCTGAACTTGAAAAGAGCGAAGGAGAGTATCAAGCTTAGTTACAGTAAT       c.2400
 Y  F  F  L  L  N  L  K  R  A  K  E  S  I  K  L  S  Y  S  N         p.800

          .         .         .         . | 17       .         .    g.39181
 AGCCCTTCTGTTTGGGATACTTTTATTGAAGGATTGAAAG | AAATGGCAAGTTCCAATCCT    c.2460
 S  P  S  V  W  D  T  F  I  E  G  L  K  E |   M  A  S  S  N  P      p.820

          .         .         .         .         .         .       g.39241
 GTGTATATGGAGATGGAAAAAGGAGATCTACCAACAAGGTTAAAGTTACTAGATGACGAG       c.2520
 V  Y  M  E  M  E  K  G  D  L  P  T  R  L  K  L  L  D  D  E         p.840

          .         .         .         .  | 18      .         .    g.39503
 GTTCCTTTTGATAGTCCGTTGTTGGTTGTTTATGCTACCCG | GTTGTATGAAAAGTTTGGG    c.2580
 V  P  F  D  S  P  L  L  V  V  Y  A  T  R  |  L  Y  E  K  F  G      p.860

          .         .         .         .         .         .       g.39563
 GAGTCTGCTCTTCGATCCTTAATCAAGTTCTTTCCATCCATTTTGCCATCGGATATCATA       c.2640
 E  S  A  L  R  S  L  I  K  F  F  P  S  I  L  P  S  D  I  I         p.880

          .         .         .         .         .         .       g.39623
 CAACTTTGTCATCATCATCCTGCTGAGTTTTTGGCCTATTTAGACAGTCTGGTGAAATCA       c.2700
 Q  L  C  H  H  H  P  A  E  F  L  A  Y  L  D  S  L  V  K  S         p.900

          .        | 19.         .         .         .         .    g.40507
 AGGCCTGAAGATCAGCG | GTCATCTTTTCTTGAGTCCCTTCTGCAACCAGAGTCTTTAAGG    c.2760
 R  P  E  D  Q  R  |  S  S  F  L  E  S  L  L  Q  P  E  S  L  R      p.920

          .         .         .         .         .         .       g.40567
 TTGGATTGGCTGCTTTTGGCAGTGTCCCTTGATGCTCCACCAAGCACCAGCACAATGGAT       c.2820
 L  D  W  L  L  L  A  V  S  L  D  A  P  P  S  T  S  T  M  D         p.940

          .        | 20.         .         .         .         .    g.41758
 GATGAAGGTTATCCCAG | GCCTCATTCACACTTGCTTTCCTGGGGTTACAGTCAGCTGATC    c.2880
 D  E  G  Y  P  R  |  P  H  S  H  L  L  S  W  G  Y  S  Q  L  I      p.960

          .         .         .         .         .         .       g.41818
 CTTCATCTAATTAAACTTCCTGCAGATTTTATAACCAAAGAGAAAATGACAGACATCTGC       c.2940
 L  H  L  I  K  L  P  A  D  F  I  T  K  E  K  M  T  D  I  C         p.980

          .  | 21      .         .         .         .         .    g.43322
 AGGTCTTGTGG | TTTCTGGCCTGGATATCTAATTCTCTGTTTGGAGCTGGAGAGAAGAAGA    c.3000
 R  S  C  G  |  F  W  P  G  Y  L  I  L  C  L  E  L  E  R  R  R      p.1000

          .         .         .         .         .         | 22    g.44956
 GAGGCCTTCACCAATATTGTGTATCTGAATGATATGAGCCTGATGGAAGGGGACAATG | GT    c.3060
 E  A  F  T  N  I  V  Y  L  N  D  M  S  L  M  E  G  D  N  G |       p.1020

          .         .         .         .         .         .       g.45016
 TGGATCCCAGAGACCGTGGAGGAATGGAAGCTTCTCCTTCATCTCATACAGAGCAAGAGC       c.3120
 W  I  P  E  T  V  E  E  W  K  L  L  L  H  L  I  Q  S  K  S         p.1040

          .         .         .         .         .         .       g.45076
 ACGAGGCCAGCCCCCCAGGAGTCACTAAATGGGAGCCTCAGTGATGGGCCTTCCCCCATC       c.3180
 T  R  P  A  P  Q  E  S  L  N  G  S  L  S  D  G  P  S  P  I         p.1060

          .         .         .         .         .         .       g.45136
 AATGTGGAGAATGTGGCACTTCTGTTAGCTAAGGCCATGGGCCCAGATCGGGCTTGGTCA       c.3240
 N  V  E  N  V  A  L  L  L  A  K  A  M  G  P  D  R  A  W  S         p.1080

          .         .         .         .         .         .       g.45196
 CTGCTACAGGAATGTGGTCTGGCCCTTGAGTTGTCAGAGAAGTTTACCAGAACCTGCGAT       c.3300
 L  L  Q  E  C  G  L  A  L  E  L  S  E  K  F  T  R  T  C  D         p.1100

          .         .          | 23        .         .         .    g.47263
 ATCCTGAGGATTGCTGAGAAAAGGCAGAG | GGCCTTGATACAAAGCATGCTTGAAAAATGC    c.3360
 I  L  R  I  A  E  K  R  Q  R  |  A  L  I  Q  S  M  L  E  K  C      p.1120

          .         .         .                                     g.47293
 GATCGGTTTCTCTGGTCCCAGCAGGCCTAG                                     c.3390
 D  R  F  L  W  S  Q  Q  A  X                                       p.1129

          .         .         .         .         .         .       g.47353
 tgggagaagattcagcaggatgtcatgacattttgagaaaaactaaatcatgctcctgaa       c.*60

          .         .         .         .         .         .       g.47413
 ccttctgaacgcatttgttattgaaggaaagacaccacccccaaatcctgccatcttatt       c.*120

          .         .         .         .         .         .       g.47473
 ggggctacttttgtcagtgtctgtacccttggcatcggcatctgtgactctttatccatg       c.*180

          .         .         .         .         .         .       g.47533
 acctcagtgtttcttaaccaaagttgtactcagcatttcttaaccaaagttgaattttga       c.*240

          .         .         .         .         .         .       g.47593
 aaagagtcagtccttgtttgctggaattagaatgttaatgtcctagtattattccgaact       c.*300

          .         .         .         .         .         .       g.47653
 acagtattaactgcttgttgctagtggattagacagattcttttcttactgtggcttcca       c.*360

          .         .         .         .         .         .       g.47713
 tgttgggagcagaagcttttcatcctggtcacatgaagacagatggtattattgactgga       c.*420

          .         .         .         .         .         .       g.47773
 gttgaattatttttatatcttgtctggcacaatatggaaattactgaaataagacggtgt       c.*480

          .         .         .         .         .         .       g.47833
 ataatggaattaacacccaaaataagtagaacactgaagatttgaatttgatatttaagt       c.*540

          .         .         .         .         .         .       g.47893
 aaaatgggactgggtgcagtggctcaggcctgtaatcccaaccctttggaaggtaaagac       c.*600

          .         .         .         .         .         .       g.47953
 gggaggatcacttgaggccaggagttcaagaccagcctgggcaacatagtgagaatgcat       c.*660

          .         .         .         .         .         .       g.48013
 ctctacaaaaaataaaaaaaattagctaggcatagtacctgaggccaggaggtccaggcc       c.*720

          .         .         .         .         .         .       g.48073
 gcaatgagatgtgtttgtgccattgcacaccagtctgggtgacagagaaagaccctgtct       c.*780

          .         .         .         .         .         .       g.48133
 caaaaacaaattaaataaaatatcttcatatataaattaagctaattaaaaatatttttc       c.*840

          .         .         .         .         .         .       g.48193
 cctgtatttatttaatattttctaatctgaacccatatacagctgactaattcattctta       c.*900

          .         .         .         .         .         .       g.48253
 gaaatgtgttatctgtaatctttcctaaacagagtagcccacaagaatcatgcacttttt       c.*960

          .         .         .         .         .         .       g.48313
 aaaattatttctaagaagccataacaaagctgtgtactaataaagactgcagcaagcact       c.*1020

          .         .         .         .         .         .       g.48373
 tgtgttatttaaattatgtaagtagattgtcatttgtcaggctcctgtacatttacatag       c.*1080

          .         .         .         .         .         .       g.48433
 catgttatattaataataaatgtaaaatatgactaaagttttcattggaacacaatgtag       c.*1140

          .         .         .         .         .         .       g.48493
 acaggaggtttattatgagcattttgcagaaaggtgtggagtaagtaaagtgttggatgc       c.*1200

          .                                                         g.48505
 actgaacaattc                                                       c.*1212

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Hermansky-Pudlak syndrome 5 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center