sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - coding DNA reference sequence

(used for variant description)

(last modified December 16, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_000334.4 in the SCN4A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011699.1, covering SCN4A transcript NM_000334.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5017
                                            ccagcaccccggggctg       c.-61

 .         .         .         .         .         .                g.5077
 cgcactgcagctccccaggccacccaccacccttctggtctctgagcccaggatgcgagg       c.-1

          .         .         .         .         .         .       g.5137
 ATGGCCAGACCATCTCTGTGCACCCTGGTGCCTCTGGGCCCTGAGTGCTTGCGCCCCTTC       c.60
 M  A  R  P  S  L  C  T  L  V  P  L  G  P  E  C  L  R  P  F         p.20

          .         .         .         .         .         .       g.5197
 ACCCGGGAGTCACTGGCAGCCATAGAACAGCGGGCGGTGGAGGAGGAGGCCCGGCTGCAG       c.120
 T  R  E  S  L  A  A  I  E  Q  R  A  V  E  E  E  A  R  L  Q         p.40

          .         .         .         .         .         .       g.5257
 CGGAATAAGCAGATGGAGATTGAGGAGCCCGAACGGAAGCCACGAAGTGACTTGGAGGCT       c.180
 R  N  K  Q  M  E  I  E  E  P  E  R  K  P  R  S  D  L  E  A         p.60

          .         .         .         .         .         .       g.5317
 GGCAAGAACCTACCCATGATCTACGGAGACCCCCCGCCGGAGGTCATCGGCATCCCCCTG       c.240
 G  K  N  L  P  M  I  Y  G  D  P  P  P  E  V  I  G  I  P  L         p.80

          .         .         .    | 02    .         .         .    g.5475
 GAGGACCTGGATCCCTACTACAGCAATAAGAAG | ACCTTCATCGTACTCAACAAGGGCAAG    c.300
 E  D  L  D  P  Y  Y  S  N  K  K   | T  F  I  V  L  N  K  G  K      p.100

          .         .         .         .         .         .       g.5535
 GCCATCTTCCGCTTCTCCGCCACACCTGCTCTCTACCTGCTGAGCCCCTTCAGCGTAGTC       c.360
 A  I  F  R  F  S  A  T  P  A  L  Y  L  L  S  P  F  S  V  V         p.120

          .         .         .   | 03     .         .         .    g.5721
 AGGCGCGGGGCCATCAAGGTGCTCATCCATGC | GCTGTTCAGCATGTTCATCATGATCACC    c.420
 R  R  G  A  I  K  V  L  I  H  A  |  L  F  S  M  F  I  M  I  T      p.140

          .         .         .         .         .         .       g.5781
 ATCTTGACCAACTGCGTATTCATGACCATGAGTGACCCGCCTCCCTGGTCCAAGAATGTG       c.480
 I  L  T  N  C  V  F  M  T  M  S  D  P  P  P  W  S  K  N  V         p.160

    | 04     .         .         .         .         .         .    g.6126
 GA | GTACACCTTCACAGGGATCTACACCTTTGAGTCCCTCATCAAGATACTGGCCCGAGGC    c.540
 E  |  Y  T  F  T  G  I  Y  T  F  E  S  L  I  K  I  L  A  R  G      p.180

          .         .         .         .         .         .       g.6186
 TTCTGTGTCGACGACTTCACATTCCTCCGGGACCCCTGGAACTGGCTGGACTTCAGTGTC       c.600
 F  C  V  D  D  F  T  F  L  R  D  P  W  N  W  L  D  F  S  V         p.200

          .  | 05      .         .         .         .         .    g.6714
 ATCATGATGGC | GTACCTGACAGAGTTTGTGGACTTGGGCAACATCTCAGCCCTGAGGACC    c.660
 I  M  M  A  |  Y  L  T  E  F  V  D  L  G  N  I  S  A  L  R  T      p.220

          .         .         .         .    | 06    .         .    g.9580
 TTCCGGGTGCTGCGGGCCCTCAAAACCATCACGGTCATCCCAG | GGCTGAAGACGATCGTG    c.720
 F  R  V  L  R  A  L  K  T  I  T  V  I  P  G |   L  K  T  I  V      p.240

          .         .         .         .         .         .       g.9640
 GGGGCCCTGATCCAGTCGGTGAAAAAGCTGTCGGATGTGATGATCCTCACTGTCTTCTGC       c.780
 G  A  L  I  Q  S  V  K  K  L  S  D  V  M  I  L  T  V  F  C         p.260

          .         .         .         .         .         .       g.9700
 CTGAGCGTCTTTGCGCTGGTAGGACTGCAGCTCTTCATGGGAAACCTGAGGCAGAAGTGT       c.840
 L  S  V  F  A  L  V  G  L  Q  L  F  M  G  N  L  R  Q  K  C         p.280

          .         .         .         .         .         .       g.9760
 GTGCGCTGGCCCCCGCCGTTCAACGACACCAACACCACGTGGTACAGCAATGACACGTGG       c.900
 V  R  W  P  P  P  F  N  D  T  N  T  T  W  Y  S  N  D  T  W         p.300

          .         .         .         .         .         .       g.9820
 TACGGCAATGACACATGGTATGGCAATGAGATGTGGTACGGCAATGACTCATGGTATGCC       c.960
 Y  G  N  D  T  W  Y  G  N  E  M  W  Y  G  N  D  S  W  Y  A         p.320

          .         .         .         .         .         .       g.9880
 AACGACACGTGGAACAGCCATGCAAGCTGGGCCACCAACGATACCTTTGATTGGGACGCC       c.1020
 N  D  T  W  N  S  H  A  S  W  A  T  N  D  T  F  D  W  D  A         p.340

          .       | 07 .         .         .         .         .    g.11418
 TACATCAGTGATGAAG | GGAACTTCTACTTCCTGGAGGGCTCCAACGATGCCCTGCTCTGT    c.1080
 Y  I  S  D  E  G |   N  F  Y  F  L  E  G  S  N  D  A  L  L  C      p.360

          .         . | 08       .         .         .         .    g.11715
 GGGAACAGCAGTGATGCTGG | GCACTGCCCTGAGGGTTATGAGTGCATCAAGACCGGGCGG    c.1140
 G  N  S  S  D  A  G  |  H  C  P  E  G  Y  E  C  I  K  T  G  R      p.380

          .         .         .         .         .         .       g.11775
 AACCCCAACTATGGCTACACCAGCTATGACACCTTCAGCTGGGCCTTCTTGGCTCTCTTC       c.1200
 N  P  N  Y  G  Y  T  S  Y  D  T  F  S  W  A  F  L  A  L  F         p.400

          .         .         .         .   | 09     .         .    g.13259
 CGCCTCATGACACAGGACTATTGGGAGAACCTCTTCCAGCTG | ACCCTTCGAGCAGCTGGC    c.1260
 R  L  M  T  Q  D  Y  W  E  N  L  F  Q  L   | T  L  R  A  A  G      p.420

          .         .         .         .         .         .       g.13319
 AAGACCTACATGATCTTCTTCGTGGTCATCATCTTCCTGGGCTCTTTCTACCTCATCAAT       c.1320
 K  T  Y  M  I  F  F  V  V  I  I  F  L  G  S  F  Y  L  I  N         p.440

          .         .         .         .         .         .       g.13379
 CTGATCCTGGCCGTGGTGGCCATGGCATATGCCGAGCAGAATGAGGCCACCCTGGCCGAG       c.1380
 L  I  L  A  V  V  A  M  A  Y  A  E  Q  N  E  A  T  L  A  E         p.460

          .         .         .         .         .         .       g.13439
 GATAAGGAGAAAGAGGAGGAGTTTCAGCAGATGCTTGAGAAGTTCAAAAAGCACCAGGAG       c.1440
 D  K  E  K  E  E  E  F  Q  Q  M  L  E  K  F  K  K  H  Q  E         p.480

          .   | 10     .         .         .         .         .    g.14141
 GAGCTGGAGAAG | GCCAAGGCCGCCCAAGCTCTGGAAGGTGGGGAGGCAGATGGGGACCCA    c.1500
 E  L  E  K   | A  K  A  A  Q  A  L  E  G  G  E  A  D  G  D  P      p.500

          .         .         .         .         .         .       g.14201
 GCCCATGGCAAAGACTGCAATGGCAGCCTGGACACATCGCAAGGGGAGAAGGGAGCCCCG       c.1560
 A  H  G  K  D  C  N  G  S  L  D  T  S  Q  G  E  K  G  A  P         p.520

          .         .         .         .       | 11 .         .    g.16501
 AGGCAGAGCAGCAGCGGAGACAGCGGCATCTCCGACGCCATGGAAG | AACTGGAAGAGGCC    c.1620
 R  Q  S  S  S  G  D  S  G  I  S  D  A  M  E  E |   L  E  E  A      p.540

          .         .         .         .         .         .       g.16561
 CACCAAAAGTGCCCACCATGGTGGTACAAGTGCGCCCACAAAGTGCTCATATGGAACTGC       c.1680
 H  Q  K  C  P  P  W  W  Y  K  C  A  H  K  V  L  I  W  N  C         p.560

          .         .         .         .         .         .       g.16621
 TGCGCCCCGTGGCTGAAGTTCAAGAACATCATCCACCTGATCGTCATGGACCCGTTCGTG       c.1740
 C  A  P  W  L  K  F  K  N  I  I  H  L  I  V  M  D  P  F  V         p.580

          .         .         .         .         .         .       g.16681
 GACCTGGGCATCACCATCTGCATCGTGCTCAACACCCTCTTCATGGCCATGGAACATTAC       c.1800
 D  L  G  I  T  I  C  I  V  L  N  T  L  F  M  A  M  E  H  Y         p.600

          .         .         .         .      | 12  .         .    g.18495
 CCCATGACGGAGCACTTTGACAACGTGCTCACTGTGGGCAACCTG | GTCTTCACAGGCATC    c.1860
 P  M  T  E  H  F  D  N  V  L  T  V  G  N  L   | V  F  T  G  I      p.620

          .         .         .         .         .         .       g.18555
 TTCACAGCAGAGATGGTTCTGAAGCTGATTGCCATGGACCCCTACGAGTATTTCCAGCAG       c.1920
 F  T  A  E  M  V  L  K  L  I  A  M  D  P  Y  E  Y  F  Q  Q         p.640

          .         .         .         .         .         .       g.18615
 GGTTGGAATATCTTCGACAGCATCATCGTCACCCTCAGCCTGGTAGAGCTAGGCCTGGCC       c.1980
 G  W  N  I  F  D  S  I  I  V  T  L  S  L  V  E  L  G  L  A         p.660

          .         .         .          | 13        .         .    g.20421
 AACGTACAGGGACTGTCTGTGCTACGCTCCTTCCGTCTG | CTGCGGGTCTTCAAGCTGGCC    c.2040
 N  V  Q  G  L  S  V  L  R  S  F  R  L   | L  R  V  F  K  L  A      p.680

          .         .         .         .         .         .       g.20481
 AAGTCGTGGCCAACGCTGAACATGCTCATCAAGATCATTGGCAATTCAGTGGGGGCGCTG       c.2100
 K  S  W  P  T  L  N  M  L  I  K  I  I  G  N  S  V  G  A  L         p.700

          .         .         .         .         .         .       g.20541
 GGTAACCTGACGCTGGTGCTGGCTATCATCGTGTTCATCTTCGCCGTGGTGGGCATGCAG       c.2160
 G  N  L  T  L  V  L  A  I  I  V  F  I  F  A  V  V  G  M  Q         p.720

          .         .         .         .         .         .       g.20601
 CTGTTTGGCAAGAGCTACAAGGAGTGCGTGTGCAAGATTGCCTTGGACTGCAACCTGCCG       c.2220
 L  F  G  K  S  Y  K  E  C  V  C  K  I  A  L  D  C  N  L  P         p.740

          .         .         .         .         .         .       g.20661
 CGCTGGCACATGCATGATTTCTTCCACTCCTTCCTCATCGTCTTCCGCATCCTGTGCGGG       c.2280
 R  W  H  M  H  D  F  F  H  S  F  L  I  V  F  R  I  L  C  G         p.760

          .         .         .         .         .         .       g.20721
 GAGTGGATCGAGACCATGTGGGACTGCATGGAGGTGGCCGGCCAAGCCATGTGCCTCACC       c.2340
 E  W  I  E  T  M  W  D  C  M  E  V  A  G  Q  A  M  C  L  T         p.780

          .         .         .       | 14 .         .         .    g.26042
 GTCTTCCTCATGGTCATGGTCATCGGCAATCTTGTG | GTCCTGAACCTGTTCCTGGCTCTG    c.2400
 V  F  L  M  V  M  V  I  G  N  L  V   | V  L  N  L  F  L  A  L      p.800

          .         .         .         .         .         .       g.26102
 CTGCTGAGCTCCTTCAGCGCCGACAGTCTGGCAGCCTCGGATGAGGATGGCGAGATGAAC       c.2460
 L  L  S  S  F  S  A  D  S  L  A  A  S  D  E  D  G  E  M  N         p.820

          .         .         .         .         .         .       g.26162
 AACCTGCAGATTGCCATCGGGCGCATCAAGTTGGGCATCGGCTTTGCCAAGGCCTTCCTC       c.2520
 N  L  Q  I  A  I  G  R  I  K  L  G  I  G  F  A  K  A  F  L         p.840

          .         .         .         .         .         .       g.26222
 CTGGGGCTGCTGCATGGCAAGATCCTGAGCCCCAAGGACATCATGCTCAGCCTCGGGGAG       c.2580
 L  G  L  L  H  G  K  I  L  S  P  K  D  I  M  L  S  L  G  E         p.860

          .         .         .         .         .         .       g.26282
 GCTGACGGGGCCGGGGAGGCTGGAGAGGCGGGGGAGACTGCCCCCGAGGATGAGAAGAAG       c.2640
 A  D  G  A  G  E  A  G  E  A  G  E  T  A  P  E  D  E  K  K         p.880

          .         .         .         .         .         .       g.26342
 GAGCCGCCCGAGGAGGACCTGAAGAAGGACAATCACATCCTGAACCACATGGGCCTGGCT       c.2700
 E  P  P  E  E  D  L  K  K  D  N  H  I  L  N  H  M  G  L  A         p.900

          .         .         .         .         .         .       g.26402
 GACGGCCCCCCATCCAGCCTCGAGCTGGACCACCTTAACTTCATCAACAACCCCTACCTG       c.2760
 D  G  P  P  S  S  L  E  L  D  H  L  N  F  I  N  N  P  Y  L         p.920

          .         .         .         .         .         .       g.26462
 ACCATACAGGTGCCCATCGCCTCCGAGGAGTCCGACCTGGAGATGCCCACCGAGGAGGAA       c.2820
 T  I  Q  V  P  I  A  S  E  E  S  D  L  E  M  P  T  E  E  E         p.940

          .         .         .    | 15    .         .         .    g.28417
 ACCGACACTTTCTCAGAGCCTGAGGATAGCAAG | AAGCCGCCGCAGCCTCTCTATGATGGG    c.2880
 T  D  T  F  S  E  P  E  D  S  K   | K  P  P  Q  P  L  Y  D  G      p.960

          .         .         .         .         .         .       g.28477
 AACTCGTCCGTCTGCAGCACAGCTGACTACAAGCCCCCCGAGGAGGACCCTGAGGAGCAG       c.2940
 N  S  S  V  C  S  T  A  D  Y  K  P  P  E  E  D  P  E  E  Q         p.980

          .         .         .         .          | 16        .    g.29164
 GCAGAGGAGAACCCCGAGGGGGAGCAGCCTGAGGAGTGCTTCACTGAGG | CCTGCGTGCAG    c.3000
 A  E  E  N  P  E  G  E  Q  P  E  E  C  F  T  E  A |   C  V  Q      p.1000

          .         .         .         .         .         .       g.29224
 CGCTGGCCCTGCCTCTACGTGGACATCTCCCAGGGCCGTGGGAAGAAGTGGTGGACTCTG       c.3060
 R  W  P  C  L  Y  V  D  I  S  Q  G  R  G  K  K  W  W  T  L         p.1020

          .         .         .         .         .         .       g.29284
 CGCAGGGCCTGCTTCAAGATTGTCGAGCACAACTGGTTCGAGACCTTCATTGTCTTCATG       c.3120
 R  R  A  C  F  K  I  V  E  H  N  W  F  E  T  F  I  V  F  M         p.1040

          .         .     | 17   .         .         .         .    g.29891
 ATCCTGCTCAGCAGTGGGGCTCTG | GCCTTCGAGGACATCTACATTGAGCAGCGGCGAGTC    c.3180
 I  L  L  S  S  G  A  L   | A  F  E  D  I  Y  I  E  Q  R  R  V      p.1060

          .         .         .         .         .         .       g.29951
 ATTCGCACCATCCTAGAATATGCCGACAAGGTCTTCACCTACATCTTCATCATGGAGATG       c.3240
 I  R  T  I  L  E  Y  A  D  K  V  F  T  Y  I  F  I  M  E  M         p.1080

          .         .         .         .         .         .       g.30011
 CTGCTCAAATGGGTGGCCTACGGCTTTAAGGTGTACTTCACCAACGCCTGGTGCTGGCTC       c.3300
 L  L  K  W  V  A  Y  G  F  K  V  Y  F  T  N  A  W  C  W  L         p.1100

          .         | 18         .         .         .         .    g.30793
 GACTTCCTCATCGTGGAT | GTCTCCATCATCAGCTTGGTGGCCAACTGGCTGGGCTACTCG    c.3360
 D  F  L  I  V  D   | V  S  I  I  S  L  V  A  N  W  L  G  Y  S      p.1120

          .         .         .         .         .         .       g.30853
 GAGCTGGGACCCATCAAATCCCTGCGGACACTGCGGGCCCTGCGTCCCCTGAGGGCACTG       c.3420
 E  L  G  P  I  K  S  L  R  T  L  R  A  L  R  P  L  R  A  L         p.1140

          .         .  | 19      .         .         .         .    g.32319
 TCCCGATTCGAGGGCATGAGG | GTGGTGGTGAACGCCCTCCTAGGCGCCATCCCCTCCATC    c.3480
 S  R  F  E  G  M  R   | V  V  V  N  A  L  L  G  A  I  P  S  I      p.1160

          .         .         .         .         .         .       g.32379
 ATGAATGTGCTGCTTGTCTGCCTCATCTTCTGGCTGATCTTCAGCATCATGGGTGTCAAC       c.3540
 M  N  V  L  L  V  C  L  I  F  W  L  I  F  S  I  M  G  V  N         p.1180

          .         .         .         .         .         .       g.32439
 CTGTTTGCCGGCAAGTTCTACTACTGCATCAACACCACCACCTCTGAGAGGTTCGACATC       c.3600
 L  F  A  G  K  F  Y  Y  C  I  N  T  T  T  S  E  R  F  D  I         p.1200

          .         .         .         .         .         .       g.32499
 TCCGAGGTCAACAACAAGTCTGAGTGCGAGAGCCTCATGCACACAGGCCAGGTCCGCTGG       c.3660
 S  E  V  N  N  K  S  E  C  E  S  L  M  H  T  G  Q  V  R  W         p.1220

          .         .         .         .         .         .       g.32559
 CTCAATGTCAAGGTCAACTACGACAACGTGGGTCTGGGCTACCTCTCCCTCCTGCAGGTG       c.3720
 L  N  V  K  V  N  Y  D  N  V  G  L  G  Y  L  S  L  L  Q  V         p.1240

  | 20       .         .         .         .         .     | 21   . g.33114
  | GCCACCTTCAAGGGTTGGATGGACATCATGTATGCAGCCGTGGACTCCCGGGAG | AAGGAG c.3780
  | A  T  F  K  G  W  M  D  I  M  Y  A  A  V  D  S  R  E   | K  E   p.1260

          .         .         .         .         .         .       g.33174
 GAGCAGCCGCAGTACGAGGTGAACCTCTACATGTACCTCTACTTTGTCATCTTCATCATC       c.3840
 E  Q  P  Q  Y  E  V  N  L  Y  M  Y  L  Y  F  V  I  F  I  I         p.1280

          .         .         .         .         .         .       g.33234
 TTTGGCTCCTTCTTCACCCTCAACCTCTTCATTGGCGTCATCATTGACAACTTCAACCAG       c.3900
 F  G  S  F  F  T  L  N  L  F  I  G  V  I  I  D  N  F  N  Q         p.1300

          .   | 22     .         .         .         .         .    g.34116
 CAGAAGAAGAAG | TTAGGGGGGAAAGACATCTTTATGACGGAGGAACAGAAGAAATACTAT    c.3960
 Q  K  K  K   | L  G  G  K  D  I  F  M  T  E  E  Q  K  K  Y  Y      p.1320

          .         .         .         .         .        | 23.    g.34825
 AACGCCATGAAGAAGCTTGGCTCCAAGAAGCCTCAGAAGCCAATTCCCCGGCCCCAG | AAC    c.4020
 N  A  M  K  K  L  G  S  K  K  P  Q  K  P  I  P  R  P  Q   | N      p.1340

          .         .         .         .         .         .       g.34885
 AAGATCCAGGGCATGGTGTATGACCTCGTGACGAAGCAGGCCTTCGACATCACCATCATG       c.4080
 K  I  Q  G  M  V  Y  D  L  V  T  K  Q  A  F  D  I  T  I  M         p.1360

          .         .         .         .         .         .       g.34945
 ATCCTCATCTGCCTCAACATGGTCACCATGATGGTGGAGACAGACAACCAGAGCCAGCTC       c.4140
 I  L  I  C  L  N  M  V  T  M  M  V  E  T  D  N  Q  S  Q  L         p.1380

          .         .         .         .         .         .       g.35005
 AAGGTGGACATCCTGTACAACATCAACATGATCTTCATCATCATCTTCACAGGGGAGTGC       c.4200
 K  V  D  I  L  Y  N  I  N  M  I  F  I  I  I  F  T  G  E  C         p.1400

          .         .         .         .         .         .       g.35065
 GTGCTCAAGATGCTCGCCCTGCGCCAGTACTACTTCACCGTTGGCTGGAACATCTTTGAC       c.4260
 V  L  K  M  L  A  L  R  Q  Y  Y  F  T  V  G  W  N  I  F  D         p.1420

          .         .         | 24         .         .         .    g.35957
 TTCGTGGTCGTCATCCTGTCCATTGTGG | GCCTTGCCCTCTCTGACCTGATCCAGAAGTAC    c.4320
 F  V  V  V  I  L  S  I  V  G |   L  A  L  S  D  L  I  Q  K  Y      p.1440

          .         .         .         .         .         .       g.36017
 TTCGTGTCACCCACGCTGTTCCGTGTGATCCGCCTGGCGCGGATTGGGCGTGTCCTGCGG       c.4380
 F  V  S  P  T  L  F  R  V  I  R  L  A  R  I  G  R  V  L  R         p.1460

          .         .         .         .         .         .       g.36077
 CTGATCCGCGGGGCCAAGGGCATCCGGACGCTGCTGTTCGCCCTCATGATGTCGCTGCCT       c.4440
 L  I  R  G  A  K  G  I  R  T  L  L  F  A  L  M  M  S  L  P         p.1480

          .         .         .         .         .         .       g.36137
 GCCCTCTTCAACATCGGCCTCCTCCTCTTCCTGGTCATGTTCATCTACTCCATCTTCGGC       c.4500
 A  L  F  N  I  G  L  L  L  F  L  V  M  F  I  Y  S  I  F  G         p.1500

          .         .         .         .         .         .       g.36197
 ATGTCCAACTTTGCCTACGTCAAGAAGGAGTCGGGCATCGATGATATGTTCAACTTCGAG       c.4560
 M  S  N  F  A  Y  V  K  K  E  S  G  I  D  D  M  F  N  F  E         p.1520

          .         .         .         .         .         .       g.36257
 ACCTTCGGCAACAGCATCATCTGCCTGTTCGAGATCACCACGTCGGCCGGCTGGGACGGG       c.4620
 T  F  G  N  S  I  I  C  L  F  E  I  T  T  S  A  G  W  D  G         p.1540

          .         .         .         .         .         .       g.36317
 CTCCTCAACCCCATCCTCAACAGCGGGCCCCCAGACTGTGACCCCAACCTGGAGAACCCG       c.4680
 L  L  N  P  I  L  N  S  G  P  P  D  C  D  P  N  L  E  N  P         p.1560

          .         .         .         .         .         .       g.36377
 GGCACCAGTGTCAAGGGTGACTGCGGCAACCCCTCCATCGGCATCTGCTTCTTCTGCAGC       c.4740
 G  T  S  V  K  G  D  C  G  N  P  S  I  G  I  C  F  F  C  S         p.1580

          .         .         .         .         .         .       g.36437
 TATATCATCATCTCCTTCCTCATCGTGGTCAACATGTACATCGCCATCATCCTGGAGAAC       c.4800
 Y  I  I  I  S  F  L  I  V  V  N  M  Y  I  A  I  I  L  E  N         p.1600

          .         .         .         .         .         .       g.36497
 TTCAATGTGGCCACAGAGGAGAGCAGCGAGCCCCTTGGTGAAGATGACTTTGAGATGTTC       c.4860
 F  N  V  A  T  E  E  S  S  E  P  L  G  E  D  D  F  E  M  F         p.1620

          .         .         .         .         .         .       g.36557
 TACGAGACATGGGAGAAGTTCGACCCCGACGCCACCCAGTTCATCGCCTACAGCCGCCTC       c.4920
 Y  E  T  W  E  K  F  D  P  D  A  T  Q  F  I  A  Y  S  R  L         p.1640

          .         .         .         .         .         .       g.36617
 TCAGACTTCGTGGACACCCTGCAGGAACCGCTGAGGATTGCCAAGCCCAACAAGATCAAG       c.4980
 S  D  F  V  D  T  L  Q  E  P  L  R  I  A  K  P  N  K  I  K         p.1660

          .         .         .         .         .         .       g.36677
 CTCATCACACTGGACTTGCCCATGGTGCCAGGGGACAAGATCCACTGCCTGGACATCCTC       c.5040
 L  I  T  L  D  L  P  M  V  P  G  D  K  I  H  C  L  D  I  L         p.1680

          .         .         .         .         .         .       g.36737
 TTTGCCCTGACCAAAGAGGTCCTGGGTGACTCTGGGGAAATGGACGCCCTCAAGCAGACC       c.5100
 F  A  L  T  K  E  V  L  G  D  S  G  E  M  D  A  L  K  Q  T         p.1700

          .         .         .         .         .         .       g.36797
 ATGGAGGAGAAGTTCATGGCAGCCAACCCCTCCAAGGTGTCCTACGAGCCCATCACCACC       c.5160
 M  E  E  K  F  M  A  A  N  P  S  K  V  S  Y  E  P  I  T  T         p.1720

          .         .         .         .         .         .       g.36857
 ACCCTCAAGAGGAAGCACGAGGAGGTGTGCGCCATCAAGATCCAGAGGGCCTACCGCCGG       c.5220
 T  L  K  R  K  H  E  E  V  C  A  I  K  I  Q  R  A  Y  R  R         p.1740

          .         .         .         .         .         .       g.36917
 CACCTGCTACAGCGCTCCATGAAGCAGGCATCCTACATGTACCGCCACAGCCACGACGGC       c.5280
 H  L  L  Q  R  S  M  K  Q  A  S  Y  M  Y  R  H  S  H  D  G         p.1760

          .         .         .         .         .         .       g.36977
 AGCGGGGATGACGCCCCTGAGAAGGAGGGGCTGCTTGCCAACACCATGAGCAAGATGTAT       c.5340
 S  G  D  D  A  P  E  K  E  G  L  L  A  N  T  M  S  K  M  Y         p.1780

          .         .         .         .         .         .       g.37037
 GGCCACGAGAATGGGAACAGCAGCTCGCCAAGCCCGGAGGAGAAGGGCGAGGCAGGGGAC       c.5400
 G  H  E  N  G  N  S  S  S  P  S  P  E  E  K  G  E  A  G  D         p.1800

          .         .         .         .         .         .       g.37097
 GCCGGACCCACTATGGGGCTGATGCCCATCAGCCCCTCAGACACTGCCTGGCCTCCCGCC       c.5460
 A  G  P  T  M  G  L  M  P  I  S  P  S  D  T  A  W  P  P  A         p.1820

          .         .         .         .         .                 g.37148
 CCTCCCCCAGGGCAGACTGTGCGCCCAGGTGTCAAGGAGTCTCTTGTCTAG                c.5511
 P  P  P  G  Q  T  V  R  P  G  V  K  E  S  L  V  X                  p.1836

          .         .         .         .         .         .       g.37208
 caggcagcatcggggtggcccactgagtctcggcatagtccccagagctcccccgtggtg       c.*60

          .         .         .         .         .         .       g.37268
 cctgcacacagagtgagggaggagggctttgaatctgggactgtgcctggctccctgatg       c.*120

          .         .         .         .         .         .       g.37328
 ggggacaggatttggccacactggggctgacacccaggcccgagcgcctgcgttcccaga       c.*180

          .         .         .         .         .         .       g.37388
 ccatgggaaatgggaattgcgctcaggggctccatgctgggtctgaggcccctgcctcca       c.*240

          .         .         .         .         .         .       g.37448
 agatttaacctgcaagttgctctgacctcctctgggccctgtcgcccctccttttggcct       c.*300

          .         .         .         .         .         .       g.37508
 gggggaggtcagaacattcgaatctctgcccctcacttgaggaggagctggcctgcggtg       c.*360

          .         .         .         .         .         .       g.37568
 gagggatcagttgccccccatcaccagagtcttaagggtcactggcctctccccaggaag       c.*420

          .         .         .         .         .         .       g.37628
 tggctcagacccctcagccccagcccagacaaagatgtcttaacctcagggagtgcagac       c.*480

          .         .         .         .         .         .       g.37688
 acctaaccccagggcactgccagcccaccccctttgactctggggtgcagcttcacccac       c.*540

          .         .         .         .         .         .       g.37748
 caggccagctcaggaattccctggaaaagggaaatgtgactggttcagaaatagctcctc       c.*600

          .         .         .         .         .         .       g.37808
 aaagcctcaaaacctgattggccactggatcctgctgctttgggctgggatggtgactcc       c.*660

          .         .         .         .         .         .       g.37868
 tgaaacctcttcctaggccacgtccaggtccgtagctcccctggctggctcctaggggaa       c.*720

          .         .         .         .         .         .       g.37928
 gagcagaaggaaggatgccacttgggaatgaattgtccttttctaggaagcacgggggag       c.*780

          .         .         .         .         .         .       g.37988
 tgagacaggctgggtcctgccagctggatcgctgcacatggcctgagcatccagacctga       c.*840

          .         .         .         .         .         .       g.38048
 gcgggagtcagggacctgctgctcagtaagaagattctcgccccttccctctctccctgc       c.*900

          .         .         .         .         .         .       g.38108
 ctcactcctccgtgagcaccaccagggctccaggagcctcatccagcctcagagatctcc       c.*960

          .         .         .         .         .         .       g.38168
 cttctcatctccccacgcccgtctctttctcacctttcccacctctctccccaaagtgat       c.*1020

          .         .         .         .         .         .       g.38228
 cctaagaatgtacagttgagctcaggttagatatttcgaccctggggcgtgcagcaggga       c.*1080

          .         .         .         .         .         .       g.38288
 aggcccaactggttcaggctcaaccttccaacttcctgtggcctgaagaagcacttctgc       c.*1140

          .         .         .         .         .         .       g.38348
 tgcatcgctgttctgggcatggcagggccaggcctctgctggctcaggaggaggggtgag       c.*1200

          .         .         .         .         .         .       g.38408
 agacctgctcaggcgtcgctggatttattcacttgtgtgtgtacctgtggctgtgtgtct       c.*1260

          .         .         .         .         .         .       g.38468
 gcttgtatgcttttataggcctgtgtgtatagctgtgtgtgtgttcaagtgcgtgactgt       c.*1320

          .         .         .         .         .         .       g.38528
 atgtgtgtgtgtgaaccactgtgtactggagcctgcattatgcacgtgtctgggtatctt       c.*1380

          .         .         .         .         .         .       g.38588
 tgtatatatgtgtatatatgtgtgccctggactgtttcaaggtccatggagtacggctgg       c.*1440

          .         .         .         .         .         .       g.38648
 tgtgtcatactgtgcaggcctgtccctgggagtgttcccgtgcctgggagagtggacctg       c.*1500

          .         .         .         .         .         .       g.38708
 tgctgtgagtgtgtggatgcgtgtgaacgcatgtggtaaggtgtgtactcagggcattct       c.*1560

          .         .         .         .         .         .       g.38768
 gttggcctaagtgcctcttctttttcttcttgtttctcatgaaaagtttgattaaaattc       c.*1620

          .         .         .         .         .         .       g.38828
 aggaagcagcaaaaccttcaaaacaagacatgtatgtgtgcttgagtgtgtgaacacgtg       c.*1680

          .         .         .         .         .         .       g.38888
 tgtgtgtgtgcacatctacatgccatgcctatgggccagagttgtctttattgtccacca       c.*1740

          .         .         .         .         .         .       g.38948
 tgctctctcacctgctcccagtcctgcctgaacagccctctctctcactcccctctcctc       c.*1800

          .         .         .         .         .         .       g.39008
 cccttcctgtttctcgttgtcacacccatggcctcagccctgctccctgcctcctgccta       c.*1860

          .         .         .         .         .         .       g.39068
 tgtctcctctatggaaggaggcctccactccttccatctcttccttcagaagtttcgtct       c.*1920

          .         .         .         .         .         .       g.39128
 aatgggggcagtctccccttcctggcacattgcccctctgccttgccctcctgggccctg       c.*1980

          .         .         .         .         .         .       g.39188
 ggctggcacagcccctggagcctcagaaatctgtttgattggatattctcctcggactgt       c.*2040

          .         .         .         .         .         .       g.39248
 gtgcaggttgcagaggaagagtagatgagccgggtccggcctctccctgcctgtggcccc       c.*2100

          .         .         .         .         .         .       g.39308
 tcccctgcagacggatgcccattcctgcctggtccagtggggaacaggtcccacgccagg       c.*2160

          .         .         .         .         .                 g.39365
 ccagcaggcgggctcctttgtacagttcttacaataaaccctccttggtgcctctgg          c.*2217

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Sodium channel, voltage-gated, type IV, alpha subunit protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center